Navigation
Open Access
Article

Genetic organization of Streptococcus salivarius 24SMBc blp-like bacteriocin locus

Maria Santagati1,*,Marina Scillato1,Stefania Stefani1
1
LabMMAR, Department of Biomedical and Biotechnological Sciences, Section of Microbiology, Via Santa Sofia 97, University of Catania, Italy
DOI: 10.2741/S512 Volume 10 Issue 2, pp.238-247
Published: 01 January 2018
(This article belongs to the Special Issue Biochemical markers in biological fluids)
*Corresponding Author(s):  
Maria Santagati
E-mail:  
m.santagati@unict.it
Abstract

In this paper, we describe, for the first time, the genetic organization of the blpU-like cassette in Streptococcus salivarius 24SMBc by entire genome sequencing. This strain has recently been found useful and widely applied as an oral probiotic in the prevention of recurrent otitis media. The 24SMBc blpU-like cassette is 8,023 bp in length, organized in 11 orfs, of which orf 8 encodes for the pore-forming peptide bacteriocin, belonging to class IIc, with a double-glycine leader peptide. The first characterization of blp locus was described in Streptococcus pneumoniae, showing a crucial role in interspecies competition within the nasopharynx. The salivarius blpU-like cassette is inserted upstream of the pepX gene in the chromosome. A hypervariable region between pepX and orf1 was found and used as a specific target able to distinguish S. salivarius 24SMBc from all other streptococci. All orfs carried by the blp-like cassette are functionally expressed (qPCR assays). Our results contribute to elucidate the microbial interactions in the nasopharynx, underlining the potential role of the blp locus in human nasopharyngeal colonization.

Key words

blp-like cassette, S. salivarius, Bacteriocin, Antagonist Activity

2. Introduction

S. salivarius, S. vestibularius, and S. termophilus make up the group of streptococcal salivarius, these are genetically similar species and are particularly important for humans (1). The first species is found only in humans and is predominant in the oropharyngeal and gastrointestinal tracts (2, 3, 4). In recent years, several publications have indicated S. salivarius as a microorganism acting positively on the oral and digestive tract ecology exerting its impact on human health through different effects on the stability of microbiota composition, generally categorized as: i) capability to adhere to epithelial cells of the host, interfering with surface colonization of other microorganisms thus limiting pathogen emergence, and ii) ability to apply a competition mechanism through the elaboration of ribosomally synthesized antimicrobial peptides, known as bacteriocins, able to compete for the same environment, both in inter- and intra-species ways (5,6). Bacteriocins (small antimicrobial peptides) have many properties that suggest their potential as an alternative to antibiotic therapy, possessing a different degree of potency, an antibacterial spectrum – both broad and narrow – the possibility to be delivered in situ and the possibility to be manipulated by bioengineering techniques (7,8).

In Gram-positive bacteria, there are two main classes of bacteriocins: i) lantibiotics (class I), which contain lanthionine and β-methil lanthionine residue as well as dehydrated amino acids; and ii) unmodified bacteriocins (class II), ribosomally synthesized peptides with minor modifications except for cleavage of leader peptides during peptide export. This latter class of bacteriocins produces a prepeptide containing a leader peptide of 14-30 amino acids with a conserved processing site of two glycine residues. The heterogeneous nature of class II bacteriocins makes a rational classification difficult. However, this class includes five subclasses: IIa, pediocin-like bacteriocins; IIb, two-peptide bacteriocins; IIc (formally class V) cyclic bacteriocin; IId non-pediocin singular linear peptide and IIe, non-ribosomal siderophore-type post-translation modification at the serine-rich carboxy-terminal region (9,10). Class II bacteriocins of lactic acid bacteria (LAB) permeabilize the target cell membrane by the formation of poration complexes that leads to the dissipation of the proton motive force (8).

S. salivarius is one of the major bacteriocin producers among all lactic acid bacteria and has been proposed as a probiotic in various clinical applications (11). A recent review of the literature found 5 different formulations containing diverse bacteriocin-producing strains: with the only exception of the TOVE-R strain, which has an unknown bacteriocin, and the K58 strain, which possesses the pantothenate inhibitor enocin, all the others produced different types of bacteriocins belonging to the salivaricin group, namely A, B, A2, 9 and M (12). Salivaricin A2 and B were the first bacteriocins characterized in Streptococcus salivarius K12, localized on a large, transmissible plasmid responsible for its inhibitory activity (13,14). Salivaricin peptides also belong to a lantibiotic subclass of which the prototype is nisin (15), but it is an atypical lantibiotic since it contains no dehydrated residues in its biologically active propeptide form and shows bacteriostatic rather than bactericidal activity versus a target bacterium.

Our studies were focused on Streptococcus salivarius 24SMBc, selected from a healthy child for its probiotic characteristics and for its remarkable ability to interfere with URTIs, mainly AOM pathogens i.e. S. pyogenes and S. pneumoniae (11, 16, 17)

Previous studies failed in the identification of the bacteriocin produced by S.salivarius 24SMBc while this study aimed at characterizing this unknown bacteriocin through the sequence of its genome. A blpU-like bacteriocin, belonging to a class IIc type with characteristics similar to peptides produced by S. pneumoniae and S. termophilus (8, 19, 20) was found. In this paper we report the genetic characterization of the blpU-like bacteriocin cassette in S. salivarius 24SMBc, its expression by qRT-PCR and a strain-specific chromosomal marker useful for its detection among all streptococcal isolates conferring a strong diagnostic significance in terms of its detection and quantification also in biological samples.

3. Materials and methods

3.1. Bacterial strains and growth conditions

S. salivarius 24SMBc and all the strains used in this study were grown in Brain Heart Infusion (BHI) broth (Oxoid, Basingstoke, UK) alone and/or with 1.5.% agar and 5% horse blood. Cultures were incubated overnight at 37 °C in 5% CO2 in air atmosphere. All strains were frozen at –70°C in BHI broth (Oxoid, Basingstone, UK) with 20% glycerol until the time of their use.

3.2. Sequencing of the blp-like bacteriocin cassette and strain-specific targeting identification

The S. salivarius 24 SMBc genome was sequenced by using Illumina sequencing technology at BMR Genomics (Padova, Italy). A preliminary assembly of the genome demonstrated 375 contigs covering 1,893,903 bp (data not shown). During this preliminary analysis the blpU-like bacteriocin locus was identified. The locus sequence was determined through assembling neighboring contigs (contigs 00333-00334-00335-00336) by Long PCR using Takara LA Taq (Takara) (21) by MS482 (5’-CCAAATACCGTGTCATCACCAAA-3’) located on the left junction and MS489 (5’- GGTGGCACTAGGTGTCTACCGC-3’) at the right end. The strain-specific targeting sequence of 24SMBc S. salivarius was amplified using MS442 (5’-GCCCTAAGCCAAAGTCAGATGA-3’) and MS443 (5’-GGTATGGCTCACCCTTTTATGTG-3’). All primers used in this study were designed by the Vector NTI software program. PCR and long PCR fragments were sequenced by direct automated methods (21).

To evaluate the specificity of the target and the lack of cross reaction with the other streptococcal species, 20 strains belonging to different streptococcal species i.e. S. salivarius (n.5), S. mitis (n.3), S. oralis (n.3), S. sanguis (n.3), S. pneumoniae (n. 2), S. agalactiae (n.2), E. faecalis (n.1), and S. aureus (n.1), were included. qPCR was performed using QuantiNovaTM Probe PCR Kit mix in an AriaMx Real-Time PCR System (Agilent Technologies). Each qPCR mixture contained 0.4.μM of each primer and 0.2. μM TaqMan probe. Thermal cycler conditions were as follows: 95 °C for 3 min, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. Each reaction was run in triplicate. Standard curves were generated by dilution series of purified DNA from 24 SMBc S. salivarius cells (107–10 genome copies).

3.3. Sequence analysis

The preliminary sequence analysis of the S. salivarius 24SMBc genome (data not shown) was performed by PRODIGAL (Prokaryotic Dynamic Programming Gene finding Algorithm; prodigal.ornl.gov) and MyRast server (Rapid Annotations using Subsystems Technology; http://blog.theseed.org/servers/). The software BLAST (22). was used to conduct homology searches of the GenBank database and the microbial genome databases available at the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov/) and at the WIT Computational Biology Group at the Argonne National Laboratory website (http://wit.mcs.anl.gov./WIT2/CGI). Protein domains were identified searching the protein family database (Pfam) available at the Wellcome Trust Sanger (http://pfam.xfam.org/).

3.4. RNA extraction and qPCR assays

For RNA isolation, S.salivarius 24SMBc was inoculated in BHI broth and incubated at 37 °C in 5% CO2 overnight. Cells were harvested in two different phases: i) the stationary phase (12 h) at an optical density of 600 nm (OD600) of 0.8.; ii) the exponential phase with an OD of 0.4. Total RNA was isolated from the cell pellets by an RNeasy kit (Qiagen, Valencia, CA, USA) treated with RNase-free DNase (Qiagen, Hilden, Germany), and eluted in RNase-free water (Ambion, Austin, TX, USA) according to the manufacturers’instructions. RNA concentration was determined spectrophotometrically and the quality was determined by analysis of the A260/280 ratio. Contaminating genomic DNA was removed from each RNA sample using Turbo DNase (Ambion) and verified by PCR. In addition, each sample was analyzed at least three times.

3.5. RT-PCR and qRT-PCR

Total RNA (10 μg) was converted into complementary DNA (cDNA) using hex nucleotide primers ImPRO-II Reverse Transcriptase Kit (Promega) according to the manufacturer’s instructions. Quantitative real-time PCR assays were performed using QuantiNovaTM Probe PCR Kit mix in an AriaMx Real-Time PCR System (Agilent Technologies). Quantitative real-time PCR (qRT-PCR) was used to evaluate the expression level of all orfs (from orf1 to orf11) carried by the bacteriocin locus. The change in the quantification cycle (ΔCq) of each sample was normalized by the sodA gene. TaqMan primers and probes were designed by Beacon DesignerTM 8.0. and are listed in Table 1. Each qPCR mixture contained 0.4.μM of each primer and 0.2. μM TaqMan probe. Thermal cycler conditions were as follows: 95 °C for 3 min, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. Expression analysis was evaluated as the increment/decrement (fold changes) of the S. salivarius strain at exponential phase versus the stationary phase. Each reaction was run in triplicate. For each analysis, three distinct biological replicates were carried out. Statistical expression analyses were performed using the Relative Expression Software Tool (REST) (23).

Table 1. Sequences of primers and probes used in this study
TargetPrimer/probe nameprimer and TaqMan probe (5’ to 3’)
orf1orf1-up
orf1-rew
orf1-Tq
AGTGGAACAAGACAAAGATA
TTGGGTGATAAAGAAATATGG
FAM-TTAAGAAGACGCTATGGCTCACC- BHQ1
orf2orf2-up
orf2-rew
or2-Tq
GCGTAAATTTGTTTAGGAGTA
GGTTCTTCTTTCTTATTTTGG
FAM-ACTGTCGTTCCTCAAGTGGAC- BHQ1
orf3orf3-up
orf3-rew
orf3-Tq
CATCCTGCTTAAGATATAGG
CGATGAAGTAATTGAAACTATC
FAM-CGAGAGTCTGCAAGTTCCGTTC-BHQ1
orf4orf4-up
orf4-rew
orf4-Tq
ATGGCTATAGGTCCTAAATG
GGAGTAGTCATTGGGAATATAG
FAM-TCTCTATCTAGTCAGCATCCAATCTGG-BHQ1
orf5orf5-up
orf5-rew
orf5-Tq
GCAAGTAAGCTAGAAAATCA GTGCTTTGTGTAGAGTTTTAC
FAM-ATACCACAGACCGCATAGCACT-BHQ1
orf6orf6-up
orf6-rew
orf5-Tq
AGGCTATAAAGAAGCAAAG CCTCGCTAATCTATTTAGAAG
FAM-AGTCCACCATACCATTAACTTGCTG-BHQ1
orf7orf7-up
orf7-rew
orf7-Tq
TCGCTCCCATTTACTAAA CTAGCAATTTTCCTTTTAGG
FAM-AAAGTGATTAATGCCAACCCTACCAAA-BHQ1
orf8orf8-up
orf8-rew
orf8-Tq
GTAGCATAGCCAACTAAAGC GTGGATGGGTTAAGTGTTATG
FAM-CACAATTGGCTCTGCTCTAGTAGGATC-BHQ1
orf9orf9-up
orf9-rew
orf9-Tq
CTGACTATAATCGCGAATATC CCTTCTCCTATGATGGTAAG
FAM-CACCGTCAAGAAGAACTCGTCCT-BHQ1
orf10orf10-up
orf10-rew
or10-Tq
GACCATCTTGCATGACTAAG GACAGAACATGCTATTATTGAC
FAM-CACCACCGCACTAAGACGATG-BHQ1
orf11orf11-up
orf11-rew
or11-Tq
TGCCTCACTGAGATAGCGAC
GCAGATACTTATCAAAGCGGAC
GCCCTCTTTCTCGCATAATATCGGCATCA
sodAsodA-up
sodA-rew
sodA-Tq
GCTTGTTGTTAACGATGA
ACGGTAGTTTAGGTAGTAAG
FAM-TTCAACTGCTAACCAAGACACTCCTAT-BHQ1

3.6. GenBank accession number

The nucleotide sequence of the blp-U-like of S. salivarius 24 SMBc has been submitted under accession number KY347796.

4. Results

4.1. Genetic organization of the blpU-like bacteriocin cassette

In order to characterize the streptococcal bacteriocin responsible for the 24SMBc antagonism activity, we sequenced the entire genome of this strain. A preliminary assembly demonstrated 375 contigs covering 1,893,903 bp, a GC content of 40.3.% and 1,736 coding sequences (data not shown). The genome sequence analysis was evaluated by Rast and Prodigal software to detect all coding sequences (CDS) present in the genome. We found only one blpU-like genetic locus of 8,023 bp carrying the blpU-like, which was involved in the bacteriocin production. In our strain, the blp cassette is organized in 11 orfs, as shown in Figure 1.(A) and function prediction of the eleven orfs is reported in Table 2. The blp cassette is inserted close to an adjacent gene (pepX) encoding for x-propyl-dipeptidyl aminopeptitase at 1,863,862 bp, as referred to the S.salivarius NCTC 8618 genome (GenBank accession no. NZ_CP009913.1.). The bacteriocin cassette in the 24SMBc strain shows a genetic structure similar to that of the other blp operon already well characterized in S. pneumoniae and S. thermophilus (18, 19, 20); particularly, it is made up of three main modules: i) the ABC-transporters that recognize the N-termini of bacteriocins and transport these peptides out of the cell with the cleavage of the double–glycine motif, ii) the bacteriocin immunity module to protect the producer bacteria from the effects of their own bacteriocins, and iii) the peptide pheromone with a typical leader peptide containing a double-glycine motif. orf8 (180 bp) appears to be a structural gene, blpU-like, encoding 59 amino acids and a pore forming peptide belonging to bacteriocin class II with a double-glycine leader that could be important for its processing to its shorter mature peptide form. The amino acidic analysis by the Pfam domains tool revealed that the blp peptide is part of the clan GG-leader CL0400 that carries a distinctive GG-cleavage motif including 5 families: bacteriocin_IIc, ComC, L_biotic_typeA, Antimicrobial17 and Lactococcin.

The multiple sequence alignment of the blpU-like peptide from three different strains, i.e. S. salivarius 24SMBc, S. salivarius K12 (NZ_ALIF01000007.1.) and S. salivarius NCTC 8618 (NZ_CP009913.1.) and blpO of S.pneumoniae (CEY55673) by clustalW showed the presence of a consensus and conserved region (amino acids 2 to 25) of a peptide belonging to the comC family (pfam03047) (Figure 2., B). It is worth stressing that orf8 shared homology also with S. pneumoniae, which would explain the strong inhibitory activity of S. salivarius 24 SMBc against S. pneumoniae, thus mediating interspecies competition. In the region downstream of orf8, two transporter genes encoding for different multidrug ABC transporter binding proteins were found: orf9, showing 99% identity at the amino acid level to the MdlB protein (581aa) and orf10, homologous (99%) to the MdlA protein (585 aa), both ABC transporter ATP-binding proteins belonging to the super family SNT encoded for ABC-type bacteriocin/lantibiotic exporters, and contain an N-terminal double-glycine peptidase domain that could be involved in the export of drugs, peptides and many other compounds (24).

At the left end of orf8, two more orfs were found: orf1, encoding the blpx_2-like protein, and orf3, belonging to EntA_Immun (pfam08951): both orfs are involved in a specific immune system responsible for the protection of the bacterium itself (shown in Figure 1. (A). Unlike other blp cassettes found in streptococcal strains, S. salivarius 24 SMBc lacks the histidine kinase genes of a two-component regulatory system controlled by a quorum-sensing mechanism.

From the few data published until now, the length of the blp bacteriocin gene cassette is variable in S. salivarius strains, ranging from 6.9. kb to 10 kb as shown in Figure 1. (A, B, C) in which the genetic organization of the blp–cassette characterized in 24SMBc (8,023 kb in size) is compared with the other two S. salivarius strains, S. salivarius K12 (6,926 bp) and NTC 8618 (10,447 bp), whose genomes have been deposited in GenBank (S. salivarius 24SMBc bp accession n KY347796; S.salivarius K12 accession n NZ_ALIF01000007.1. and S.salivarius NTC 8618 accession n NZ_CP009913.1.). The genetic element of our strain appeared to be more related to the blpU-locus present in S.salivarius NTC8618 except for the absence of regulatory genes – DNA-binding response regulator and histidina kinase – however, orf1,orf3, orf5, orf8, 9, 10 and orf11 are conserved in all structures. The sequence analysis of the blp-structure identified the specific target that distinguishes our strain from other S. salivarius strains. This DNA sequence was 241 bp in size (from 2233 bp to 2504) located between the x-propyl-dipeptidyl aminopeptitase gene and orf1. To evaluate the inter- and intra-species cross reaction, 20 strains belonging to S. salivarius, S. mitis, S. oralis, S. sanguis, S. pneumoniae, S. agalactiae, E. faecalis and S. aureus were also included in this study.

Strain-specific targeting was evaluated by the absolute genomic copy number using high-quality standard curve parameters in terms of R2 (coefficient of correlation), M (slope) and E (efficiency) of ≥ 0.9.9, -3.1./-3.6., 90-100%, respectively. We found high sensitivity and specificity (from 84% to 100%), able to identify and quantify the presence of our strain among many different Gram-positive bacteria evaluated in three limits of detection (LOD): 104,103, 102 genome copies.

Table 2. Homologies of the blp cassette ORFs
ORF(aa)Homologous gene (accession no)OriginProposed function of gene productPfam domainsE-valueAmino acid identity
PepX (755 aa)
Integration site
x-prolyl-dipeptidyl aminopeptidase (KEO44511 )S. salivariusX-prolyl-dipeptidyl aminopeptidasePepX_N (pfam09168)
PepX_C (pfam08530)
0.0.731/755 (97%)
orf1 (126 aa)blpX_2
(CVX48085)
S. pneumoniaePutative bacteriocin self-immunity protein3e-77116/126 (92%)
orf2 (108 aa)putative membrane protein(CVX48107)S.pneumoniaePutative membrane protein1e-5094/104 (90%)
orf3 (98 aa)EntA_Immun
(CDF03895)
S.salivariusImmunity proteinEnterocin A Immunity pfam089513e-6296/98 (98%)
orf4 (59 aa)hypothetical protein (ALR80594 )S.salivariusHypothetical protein3e-2651/54 (94%)
orf5 (133 aa)hypothetical protein
(AJFW01000020.1.)
S.salivariusPutative integral membrane proteinPutative integral membrane protein (DUF2391)3e-71120/133 (90%)
orf6 (55 aa)hypothetical protein
(LRQS02000062.1.)
S.salivariusHypothetical membrane protein4e-3054/55 (98%)
orf7 (55 aa)putative membrane protein (FDNI01000011)S.pneumoniaePutative membrane protein3e-2954/55 (98%)
orf8 (59aa)bacteriocin class II with double-glycine leader peptide (JJMT01000019.1.)S.salivariusPore-forming peptide, peptide
(blpU –like)
COMC family; pfam03047
Bacteriocin_IIc pfam10439
8e-3359/59 (100%)
orf9 (581 aa)MdlB; multidrug ABC transporter ATP-binding protein (CP009913.1.)S.salivariusABC-type multidrug transport system, ATPase and permease componentABC transporter transmembrane region; pfam00664
ATP-binding cassette domain of glucan transporter, cd03254
0.0.579/581 (99%)
orf10 (585 aa)multidrug resistance-like ATP-binding protein mdlA
(FR873481.1.)
S.salivariusATP-binding cassette domain of iron-sulfur clusters transporter, subfamily CABC transporter transmembrane region; pfam00664
P-loop containing Nucleoside Triphosphate Hydrolases; cl21455
0.0.579/585 (99%)
orf 11 (150 aa)hypothetical protein
CP009913.1.
S.salivariusHypothetical protein6e-105144/148 (97%)

Figure 1. Genetic organization of the blp-like cassette of S. salivarius 24SMBc and comparison with the corresponding locus in other S. salivarius strains. (A) schematic representation of the blp-U like locus of S. salivarius 24SMBc, the presumed functional designations are indicated by the color of the ORF. The left integration site, pepx gene, is in the blue box. The DNA region between pepX and orf1 is a strain specific target (pink). (B) genetic organization of the blp locus of S.salivarius K12 (B) and NTC 8618 (C ).

Figure 2. Amino acid alignment of putative bacteriocins by clustalW showing the homology between predicted structural peptides: blpU-like from S. salivarius 24SMBC, K12 and NTC8618 and blpO S. pneumoniae (A) proving the consensus and conserved region of a peptide belonging to the comC family (amino acids 2 to 25) (B).

4.2. Expression study of ofrs carried by the blp-U cassette

The expression of all orfs present in the blp bacteriocin cassette, evaluated by qPCR at the exponential and stationary phases of growth, showed that all orfs were transcribed – at different levels – in both growth phases. The relative quantitative expressions of orfs are shown in Figure 3. expressed as fold changes of the exponential phase compared with the stationary phase. It is noteworthy that only two orfs; orf1 and 5, encoding, respectively, for bacteriocin self-immunity and integral membrane proteins, appeared to be unregulated in the stationary phase with respect to other orfs that showed a high transcription level during the exponential phase.

Figure 3. Relative quantitative expression of all orfs characterized in the 24SMBc strain evaluating the expression level in overnight culture versus exponential growth.

5. Discussion and Conclusion

blp bacteriocin cassettes provide an interesting mechanism for competition among different streptococcal species including pathogens and commensal strains, contributing to the changing microbial environment of the nasopharyngeal microbiota. To date, this locus has been characterized in detail only in S. pneumoniae and S. thermophilus showing a high heterogeneity between isolates as demonstrated by the available genome sequences. This phenomenon suggests that there is an ongoing positive selective pressure exerted on this locus so that it always remains effective and beneficial to the success of the organism (18, 19, 25). This work describes, for the first time, the genetic organization of the blpU-like bacteriocin cassette in Streptococcus salivarius 24SMBc and its genetic expression. The cassette contains the genes required for inhibitory activity against S.pneumoniae, S.pyogenes and other closely related Gram-positive bacteria. This genetic structure shows strong similarity to other blp operons already characterized in S.pneumoniae and S.thermophilus, having the same genetic organization except for the HK regulator and response systems that are absent in our strain. The genome sequence analysis of Streptococcus salivarius 24SMBc showed the presence of only one locus involved in bacteriocin production, characterized by carrying orf8 encoding for a pore forming peptide belonging to bacteriocin class IIc. Furthermore, in our strain other bacteriocin producing loci were absent, such as those belonging to the group of salivaricins commonly described in S.salivarius. Our data, for the first time, highlight the functionality of the blp locus present on the S.salivarius genome that could be masked by the strong activity of other bacteriocins, such as S. salivarius K12. (14).

Using real-time gene expression, it was found that all orfs are expressed during the exponential phase while only orf 1 and 5, encoding respectively for bacteriocin self-immunity and integral membrane proteins, appeared to be upregulated in the stationary phase with respect to other orfs. Further expression data are necessary to determine exactly what factors stimulate over expression of bacteriocin self-immunity at the stationary phase considering that this cluster appears to not be regulated by a classic quorum sensing two-component regulatory system lacking histidine-kinase and regulatory proteins (BlpH-R) in 24SMBc. It could be argued that the increased expression of the proteins involved in the immune system at the late phase could ensure increased protection against the strain’s production of bacteriocin. The studies to understand the cause of such changes of gene expression in relation to growth stages are ongoing in our lab.

Since the left end of the blp-cassette showed DNA variability among S.salivarius strains, this DNA region was used by qPCR as a strain specific genomic marker capable of discriminating the 24SMBc strain from other streptococcal strains. We also demonstrated the high sensitivity and specificity of this genomic target against different strains and species i.e. S.salivarius, S.mitis, S.oralis, S.sanguis, S.pneumoniae, S.agalactiae, E.faecalis and S.aureus, showing the lack of inter- and intra-species cross reaction up to 103 and 104 genome copies. The use of a strain specific qPCR assay for probiotic strains, as well as for 24SMBc, which is already being used as an oral probiotic, can provide probiotic strain monitoring, by detection and quantification in various sources including biological samples, mixed cultures or environments harboring hundreds of species.

It is remarkable that there are many genetic methods available to successfully identify one strain or probiotic bacteria from among other strains, such as randomly amplified polymorphic DNA (RAPD), pulsed-field gel electrophoresis, PCR amplification of repetitive bacterial DNA elements (rep - PCR) or ribotyping (26). However, all these assays do not allow rapid detection and quantification of specific strains in different samples and, furthermore, they are applied to pure isolates or DNA extract from pure culture and the main problem in various studies is to evaluate the efficiency of probiotic strains by bacterial detection/quantification in biological samples. In this context, our strategy could detect the probiotic strain and measure its efficacy and effectiveness, which are required to prove that these strains can confer specific disease reduction or clinical treatment benefits.

It is well known that bacteriocins play a fundamental role in the intra- and inter-species competition between the normal oral streptococcal species and pneumococci, contributing to maintain the complex equilibrium between a healthy state and the progression toward disease within the normal range (20, 27) Streptococcus salivarius species is one of the pioneer strains, colonizing the oropharyngeal and gastrointestinal tracts in newborns, remaining predominant throughout the human life span, and capable of improving health-associated oral and gut microbiota just by interfering with potential pathogens (28).

Many studies have highlighted the close correlation between the reduction of potential pathogens and the presence of commensal streptococci. The alteration of the nasopharyngeal microbiota and the absence or reduction of α-streptococci may correlate with the pathogenesis of URTIs and, in particular, with recurrent acute otitis media (rAOM), acting as a reservoir for mainly respiratory pathogens such as Streptococcus pneumoniae, Haemophilus influenzae, and Moraxella catarrhalis (29, 30).

In conclusion, our probiotic strain, S.salivarius 24SMBc, harbors a blp-like bacteriocin carrying a cassette with high genetic variability, similar to constructs found in other streptococcal species, i.e. S.pneumoniae and S.thermophilus. Furthermore, all genes are expressed in this strain in both the exponential and stationary phase of growth even if they lack the regulator system found in S.peneumoniae. Our data on the blp cassette of S.salivarius can provide additional information about intra- and inter-species competition altering and/or rebalancing the nasopharyngeal microbiota.

6. Acknowledgements

We thank the Scientific Bureau of the University of Catania for the language support. This study was supported by a grant from DMG Italia and FIR2014(A4CA57).

References

    1. Delorme C, Abraham AL, Renault P, Guédon E. Genomics of Streptococcus salivarius, a major human commensal. Infect Genet Evol. 33, 381-92 (2015)
    DOI: 10.1016/j.meegid.2014.10.001
    PMid:25311532

    2. Qin J, Li R, Raes J, Arumugam M, Burgdorf KS, Manichanh C, Nielsen T et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature 4, 464(7285):59-65 (2010)

    3. Park HK, Shim SS, Kim SY, Park JH, Park SE, Kim HJ, Kang BC, Kim CM. Molecular analysis of colonized bacteria in a human newborn infant gut. J Microbiol. 43(4):345-53 (2005)
    PMid:16145549

    4. Wang M, Ahrné S, Jeppsson B, Molin G. Comparison of bacterial diversity along the human intestinal tract by direct cloning and sequencing of 16S rRNA genes. FEMS Microbiol Ecol.5.4:219–231 (2005)
    DOI: 10.1016/j.femsec.2005.03.012
    PMid:16332321

    5. Mignolet J, Fontaine L, Kleerebezem M, Hols P. Complete Genome Sequence of Streptococcus salivarius HSISS4, a Human Commensal Bacterium Highly Prevalent in the Digestive Tract. Genome Announc. 4;4(1) 2016.

    6. Burton JP, Wescombe PA, Cadieux PA, Tagg JR. Beneficial microbes for the oral cavity: time to harness the oral streptococci? Benef Microbes 2:93–101 (2011)
    DOI: 10.3920/BM2011.0002
    PMid:21840808

    7. Hassan M, Kjos M, Nes IF, Diep DB, Lotfipour F. Natural antimicrobial peptides from bacteria: characteristics and potential applications to fight against antibiotic resistance. J Appl Microbiol. 113(4):723-36 (2012)
    DOI: 10.1111/j.1365-2672.2012.05338.x
    PMid:22583565

    8. Cotter PD, Ross RP, Hill C. Bacteriocins - a viable alternative to antibiotics? Nat Rev Microbiol. 11(2):95-105 (2013)
    DOI: 10.1038/nrmicro2937
    PMid:23268227

    9. Franz CM, van Belkum MJ, Holzapfel WH, Abriouel H, Gálvez A. Diversity of enterococcal bacteriocins and their grouping in a new classification scheme. FEMS Microbiol Rev. 31(3):293-310 (2007)
    DOI: 10.1111/j.1574-6976.2007.00064.x
    PMid:17298586

    10. Yang SC, Lin CH, Sung CT, Fang JY. Antibacterial activities of bacteriocins application in foods and pharmaceuticals. Front Microbiol.5:6835 (2014)
    DOI: 10.3389/fmicb.2014.00683
    DOI: 10.3389/fmicb.2014.00241
    PMid:24904554 PMCid:PMC4033612

    11. Marchisio P, Santagati M, Scillato M, Baggi E, Fattizzo M, Rosazza C, Stefani S, Esposito S, Principi N. Streptococcus salivarius 24SMB administered by nasal spray for the prevention of acute otitis media in otitis-prone children. Eur J Clin Microbiol Infect Dis. 34(12):2377-83 (2015)
    DOI: 10.1007/s10096-015-2491-x
    PMid:26385346

    12. Wescombe PA, Hale JD, Heng NC, Tagg JR. 7. Developing oral probiotics from Streptococcus salivarius Future Microbiol. 12:1355-71 (2012)
    DOI: 10.2217/fmb.12.113
    PMid:23231486

    13. Tagg JR. Prevention of streptococcal pharyngitis by anti-Streptococcus pyogenes bacteriocin-like inhibitory substances (BLIS) produced by Streptococcus salivarius Indian J Med Res. 119. Suppl:13-6 (2004)
    PMid:15232154

    14. Hyink O, Wescombe PA, Upton M, Ragland N, Burton JP, Tagg JR. salivaricin A2 and the novel lantibiotic salivaricin B are encoded at adjacent loci on a 190-kilobase transmissible megaplasmid in the oral probiotic strain Streptococcus salivarius K12. Appl Environ Microbiol.7.3(4):1107-13 (2007)

    15. Gross, E., and J. L. Morell. The structure of nisin. J. Am. Chem. Soc. 93:4634-4635 (1971)
    DOI: 10.1021/ja00747a073
    PMid:5131162

    16. Santagati M, Scillato M, Patanè F, Aiello C, Stefani S. Bacteriocin-producing oral streptococci and inhibition of respiratory pathogens. FEMS Immunol Med Microbiol 65(1):23-31 (2012)
    DOI: 10.1111/j.1574-695X.2012.00928.x
    PMid:22243526

    17. Santagati M, Scillato M, Muscaridola N, Metoldo V, La Mantia I, Stefani S. Colonization, safety, and tolerability study of the Streptococcus salivarius 24SMBc nasal spray for its application in upper respiratory tract infections. Eur J Clin Microbiol Infect Dis. 34(10):2075-80 (2015)
    DOI: 10.1007/s10096-015-2454-2
    PMid:26205666

    18. Renye JA Jr, Somkuti GA. BlpC-regulated bacteriocin production in Streptococcus thermophilus. Biotechnol Lett. 35(3):407-12 (2013)
    DOI: 10.1007/s10529-012-1095-0
    PMid:23183916

    19. Son MR, Shchepetov M, Adrian PV, Madhi SA, de Gouveia L, von Gottberg A, Klugman KP, Weiser JN, Dawid S. Conserved mutations in the pneumococcal bacteriocin transporter gene, blpA, result in a complex population consisting of producers and cheaters. MBio. 6;2(5) (2011)

    20. Valente C, Dawid S, Pinto FR, Hinds J, Simões AS, Gould KA, Mendes LA, de Lencastre H, Sá- Leão R. The blp locus of Streptococcus pneumoniae plays a limited role in the selection of strains that can cocolonize the human nasopharynx. Appl Environ Microbiol. 15;82(17):5206-15 (2016)

    21. Iannelli F, Santagati M, Santoro F, Oggioni MR, Stefani S, Pozzi G. Nucleotide sequence of Conjugative prophage Φ1207.3. (formerly Tn1207.3.) carrying the mef(A)/msr(D) genes for efflux resistance to macrolides in Streptococcus pyogenes. Front Microbiol. 9;5:687 (2014)

    22. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 5;215(3):403-10 (1990)

    23. Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res.1;30(9) (2002)

    24. Hipfner DR, Deeley RG, Cole SP. Structural, mechanistic and clinical aspects of MRP1. Biochim Biophys Acta, 6;1461(2):359-76 (1999)

    25. Dawid S, Roche AM, Weiser JN. The blp bacteriocins of Streptococcus pneumoniae mediate intraspecies competition both in vitro and in vivo. Infect Immun 75(1):443-51 (2007)
    DOI: 10.1128/IAI.01775-05
    PMid:17074857 PMCid:PMC1828380

    26. Treven P. Strategies to develop strain-specific PCR based assays for probiotics. Benef Microbes, 6(6):887-98 (2015)
    DOI: 10.3920/BM2015.0009
    PMid:25869283

    27. Human Microbiome Project Consortium. Structure, function and diversity of the healthy human microbiome. Nature 486, 207–21 (2012).
    DOI: 10.1038/nature11234
    PMid:22699609 PMCid:PMC3564958

    28. Roos K, Håkansson EG, Holm S. Effect of recolonisation with “nterfering” alpha streptococci on recurrences of acute and secretory otitis media in children: randomized placebo controlled trial. BMJ. 2.7322(7280): 210-2. (2001)

    29. Marchisio P, Claut L, Rognoni A, et al. Differences in nasopharyngeal bacterial flora in children with non-severe recurrent acute otitis media and chronic otitis media with effusion: implications for management. Pediatr Infect Dis J 22 262-268 (2003)
    DOI: 10.1097/00006454-200303000-00012
    DOI: 10.1097/01.inf.0000055063.40314.da
    PMid:12634589

    30. Kaieda S, Yano H, Okitsu N, Hosaka Y, Okamoto R, Inoue M, Takahashi H. Investigation about the homogeneity of nasopharyngeal microflora at the different location of nasopharynx of children with acute otitis media. Int J Pediatr Otorhinolaryngol, 69(7):959-63 (2005)
    DOI: 10.1016/j.ijporl.2005.01.036
    PMid:15911015

Share and Cite
Maria Santagati, Marina Scillato, Stefania Stefani. Genetic organization of Streptococcus salivarius 24SMBc blp-like bacteriocin locus. Frontiers in Bioscience-Scholar. 2018. 10(2); 238-247.