Open Access
Review

Emerging roles of microRNAs in the regulation of Toll-like receptor (TLR)-signaling

Saswati Banerjee1,Winston E. Thompson1,Indrajit Chowdhury2,*
1
Department of Physiology, Morehouse School of Medicine, Atlanta, GA, USA
2
Department of Obstetrics and Gynecology, Morehouse School of Medicine, Atlanta, GA, USA
DOI: 10.2741/4917 Volume 26 Issue 4, pp.771-796
Published: 01 October 2020
(This article belongs to the Special Issue Recent progress in reproductive biology)
*Corresponding Author(s):  
Indrajit Chowdhury
E-mail:  
indrajitfbs@gmail.com
Abstract

Toll-like receptors (TLRs) are evolutionarily conserved molecules that detect exogenous and endogenous molecular patterns and trigger both the innate and adaptive immune systems to initiate a pathogen-specific immune response and eliminate the threat. However, sustained, or prolonged activation of the immune system disrupts immunological homeostasis and leads to chronic or acute inflammatory diseases. MicroRNAs (miRNAs) can intervene in the initiation and modulation of the complex immunoregulatory networks via regulating the expression of TLRs and multiple components of TLR-signaling pathways including signaling proteins, transcription factors, and cytokines. Moreover, the aberrant expression of TLRs can induce the expression of several miRNAs which in turn regulate the expression of TLR signaling components and TLR-induced cytokines. The present review aims to highlight the emerging roles of miRNA in the regulation of TLR signaling, the interaction between the miRNAs and TLRs, and their implication in inflammatory diseases.

Key words

miRNA, TLR, Immunity, Cytokine, SNAP, Chemokine, Review

2. Introduction

The immune system is a complex network of immune organs, cells, and soluble factors (cytokines) that act locally or systemically through an immediate (innate) inflammatory response by cytokines and phagocytes, and a specific tailored immune response through adaptive immune cells, or a regulated immune-tolerant response. The differing, and sometimes opposing, roles of the immune system are mediated by a complex interplay of intracellular and extracellular signaling pathways. Cells of the immune system participate in the protection of the host from invading pathogens, foreign antigens, and incipient tumor cells, and in development, maintenance of homeostasis, tissue repair and regeneration processes for wound healing (1). The innate immune system depends on the pattern recognizing receptors (PRRs), includes components of the complement system and Toll-like receptors (TLRs) family. TLRs are membrane-associated innate-immune sensors that detect the external pathogen-associated molecular patterns (PAMPs) or the internal damage-associated molecular patterns (DAMPs) and execute subsequent immune cell response (2-4). TLRs, the most extensively studied PRRs, are type-I transmembrane glycoprotein receptors. TLRs consist of three structurally important domains namely an ectodomain consisting of hydrophobic leucine-rich repeat region (LRR) for ligand recognition/binding at N-terminus and formation of functional dimers to initiate the signaling cascade, a single transmembrane helix, and a conserved cytoplasmic Toll/Interleukin-1 (IL-1) receptor (TIR) domain at C-terminus required for the activation of downstream intracellular signal transduction pathways (5, 6). Interestingly, the extracellular ligand-binding domains of TLRs contain hydrophobic leucine-rich repeat motifs that form horseshoe-shaped solenoid structures and contain an extensive β-sheet on its concave surface, and numerous ligand-binding insertions (7). TLRs are distinguished based on their ligand specificity, signal transduction pathways, and subcellular localization (8). In mammals, ten human (TLR1-10), and 13 murine TLR protein subfamily (TLR1-9, TLR11-13) have been identified with a functional difference among humans and mice (5, 9-11). TLRs are functionally classified into two categories. The group I TLRs include TLR1, TLR2, TLR4, TLR5, TLR6, and TLR10, and are expressed on the cell membrane and recognize microbially derived lipopolysaccharide (LPS) and lipopeptide ligands (12). The group II TLRs include TLR3, TLR7, TLR8, and TLR9, and are primarily expressed on vesicles and located intracellularly in the endoplasmic reticulum (ER), endosomes, and lysosomes compartments and recognize microbial nucleic acids released from stressed or dying cells (13-15). Unlike the other TLRs, TLR3 is expressed both on the cell surface and in intracellular vesicles and recognize viral dsRNA (16). Thus, TLRs are expressed in all tissues including macrophages, NK cells, DCs, circulating monocytes and neutrophils of the innate immune system; the adaptive immune cells (T and B lymphocytes), as well as non-immune cells and organs, e.g. epithelial and endothelial cells, fibroblasts, brain, skeletal muscle, heart, lung, small intestine, liver, pancreas, colon, kidney, ovary, placenta, testis and prostate (17, 18).

MicroRNAs (miRNAs) have received considerable attention due to their involvement in the post-transcriptional regulatory mechanisms in almost all known cellular processes including development, differentiation, apoptosis, and the innate and adaptive immune responses to pathogen infections (19-26). Besides, extracellular miRNAs secreted from the donor cells could be delivered into recipient cells via extracellular vesicles and exosomes to establish a cell-cell communication system during various physiological and pathological processes (27-32). Selective miRNA studies in context to the regulation of TLRs suggest that miRNAs can modulate TLR signaling either through their involvement via transcriptional regulation or serving as physiological ligands of TLRs. Moreover, studies suggest that miRNA expression can be directly regulated by TLRs pathway (33). Interestingly, TLR activation modulates the expression of miRNAs that regulate TLR signaling either by the direct targeting of the molecules in the TLR pathway or indirectly through altering the activity of other cellular pathways that participate in crosstalk. The present review is highlighting the implication of TLRs in diseases and the emerging roles of microRNA (miRNA) in regulation of TLRs signaling.

3. Pathophysiology of TLR-signaling

TLRs are the cell-surface initiators that trigger the inflammatory process. TLRs recognize conserved microbial-associated molecular patterns including LPS (TLR4), diacyl and triacyl lipopeptides, and zymosan (TLR2 associated with TLR1 or TLR6), peptidoglycan and lipoarabinomannan (TLR2), bacterial flagellin (TLR5), viral dsRNA (TLR3), viral or bacterial ssRNA (TLRs 7 and 8), HMGB1 (TLR2 and TLR4), and CpG-rich unmethylated DNA (TLR9) among others (34-36) (Figure 1). Several TLRs require to interact with their coreceptors to form homo- or heterodimers for ligand binding, such as TLR1 or TLR6 for TLR2, MD2 for TLR4, and CD14 for TLR2, TLR4, and TLR3 (37). Being a critical component of the inflammatory response system to pathogen invasion, TLR-signaling is regulated at multiple levels. These include binding of TLRs to ligands, cooperation with coreceptor molecules and dimerization, recruiting adaptor molecules upon ligand binding, leading to transcription factor activation and downstream signaling (38).

Figure 1. A schematic diagram is showing the Toll-like receptors (TLR) signaling pathway and downstream effector molecules. Depicted are key TLR molecules, their signaling adaptors and downstream mediators that are essential for TLR signaling and function. TLRs 1, 2, 4, 5 and 6 are expressed on the cell surface, while TLRs 3, 7, 8 and 9 are expressed intracellularly on endosomal membranes. Activation of the TLRs leads to recruitment of the adaptor molecules MyD88, TIRAP, TRIF and TRAM. Downstream signals involve TAK1, MAPKs, TRAF3, TBK1 and IKKs, resulting in nuclear translocation of transcriptions factors (AP-1, NF-κB, IRF-3 or IRF-7) into the nucleus and transcription of inflammatory genes.

Upon binding to the ligand two extracellular domains form an “m”-shaped structure sandwiching the ligand molecule and bringing the transmembrane and cytoplasmic domains close by to induce the downstream signals (39). After activation of TLR signaling pathways, the TIR domain recruits five different types of intracellular adaptor proteins including Myeloid differentiation primary response gene 88 (MyD88), Sterile α- and armadillo-motif-containing protein (SARM), TIR domain-containing adaptor protein (TIRAP or MAL), TIR domain-containing adaptor protein inducing IFN-β (TRIF) and TRIF-related adaptor molecule (TRAM) (2, 40, 41). Based on the recruited adaptor protein the TLR induced signaling cascade can be activated either by MyD88-dependent or by TRIF-dependent pathway (42-45). Signaling through TLR1, TLR2, TLR5, TLR6, TLR7, TLR8, and TLR9 are activated via MyD88-dependent pathway that subsequently leads to the activation of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and mitogen-associated protein kinase (MAPK) and produces the pro-inflammatory cytokines and chemokines (11). Activation through TIRAP is also linked via MyD88 and is associated with TLR2 and TLR4 (46, 47). TLR3-induced signaling is activated by the TRIF-dependent pathway and associated with the production of Interferon type-1 (6). Whereas TLR4 signaling is mediated by both MYD88-dependent as well as TRAM/TRIF dependent pathways (6, 42, 43, 48). In contrast, SARM negatively regulates TRIF thus controlling the TLR3 and TL4 signaling pathways (49, 50).

The interaction between a TLR and a microbial component triggers the initiation and the activation of the innate immune system, which not only initiates immediate host defensive responses such as inflammation but also prime and orchestrate antigen-specific adaptive immune responses (51). Upon engagement with PAMPs or DAMPs, TLRs recruit the adaptor proteins that lead to the activation of different transcription factors like NF-휅B, interferon regulatory factor IRF3, IRF7, activator protein-1 (AP1), and releasing the pro-inflammatory cytokines like tumor necrosis factor-alpha (TNF-α), interleukin (IL)-1β and IL-6 and type 1 interferon (IFN-α, β), chemokines (CXCL8 and CXCL10), and antimicrobial peptides (52-54). Ultimately, all together they activate the adaptive immune system. Although the TLR-induced inflammatory cytokines are required as a part of the defense system to clear pathogens, however, the overproduction of many of these cytokines and chemokines are toxic and can cause pathological inflammation in the host. Overactivation of the TLR pathway disrupts the immune homeostasis through sustain pro-inflammatory cytokines and chemokines production and consequently contributes to the development of inflammatory and autoimmune diseases including systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), Behcet's disease, chronic hepatitis B virus (HBV), sepsis, Alzheimer's disease, and even cancer (55-58). Thus, fine-tuning of the TLR-signaling pathways is required to prevent excessive inflammation and maintain the homeostasis (53, 59, 60), even though the transcription factors and message translation can be regulated by post-transcriptional modification of the key proteins involved in the signaling cascade.

4. MicroRNA (miRNA) and Biogenesis

miRNAs are small non-coding single-stranded RNA molecules with 18-24 nucleotides in length. miRNAs bind to the 3’ untranslated region (UTR) of the target mRNA leading to mRNA degradation, thus repressing translation of the respective targets (24). However, miRNAs are also known to interact with other regions, including the 5′ UTR and coding sequence and have silencing effects on gene expression (61, 62). Since a very short complementary sequence (6-8 nucleotide) is needed to bind to the target mRNA, a single miRNA can target hundreds or thousands of different mRNAs and thus being capable of controlling 30% of the human protein-encoding genes (63, 64). Ultimately, miRNAs in conjunction with other miRNAs and transcription factors post-transcriptionally regulate pathways and networks related to a variety of biological processes. Moreover, the interaction of miRNA with the promoter region has been also reported to modulate the gene expression (65).

The biogenesis of miRNAs is a complex process and is under tight temporal and spatial control. The dysregulation of miRNAs is found to be associated with the progression of multiple human diseases (27, 66-70). miRNAs are transcribed from genomic DNA by RNA polymerases II and III, generating precursors primary miRNAs (pri-miRNAs) that undergo a series of cleavage events to form mature microRNA (71). The biogenesis starts with the processing of pri-miRNAs and follows either the canonical or non-canonical pathway. In the canonical pathway pri-miRNAs that are more than 200 nucleotides in length undergo a nuclear cleavage by an endonuclease complex consisting of RNase II enzyme Drosha and the DiGeorge critical region 8 protein (DGCR8) into a 60-70 nucleotide-long precursor miRNA (pre-miRNA) (72-75). The pre-miRNA is exported to the cytoplasm in an Exportin5/RanGTP-dependent manner and undergo cleavage by the RNase III family enzyme Dicer into ~22 nucleotide-long mature microRNA duplex (76-79). Finally, either of the 5p or 3p strands of the mature miRNA duplex known as guide strand is loaded into the Argonaute (AGO) family of proteins to form a miRNA-induced silencing complex (miRISC) (80). Whereas the non-canonical pathway can be grouped into Drosha/DGCR8-independent and Dicer-independent pathways (81). Mirtrons have a pre-miRNA that is defined by the entire length of the intron in which they are located and are produced during splicing as the first step in their biogenesis (82, 83). The pre-miRNA excised by splicing which is subsequently linearized by the debranching enzyme, Ldbr (DBR1 in humans), allowing the intron to form a structure that is exported to the cytoplasm by XPO5/RanGTP, recognized and cleaved by the Dicer complex to form a mature miRNA (82, 84, 85). Albeit, 7-methylguanosine (m7G)-capped pre-miRNA is processed by a Drosha-independent pathway. Initially, the pre-miRNAs are directly exported to the cytoplasm through PHAX/exportin-1 and finally cleaved by Dicer to a mature miRNA. After Dicer cleavage, only the 3p-miRNA is efficiently loaded onto Argonaute to form a functional microRNP (86). Dicer-independent miRNAs are processed by Drosha from endogenous short hairpin RNA (shRNA) transcripts to generate pre-miRNAs hairpin that is directly cleaved by Ago2 and followed by resection of its 3′ terminus (87). All pathways ultimately lead to a functional miRISC complex as a biologically active miRNA that binds 3’-UTR of the target mRNA which leads to mRNA degradation or repression of protein translation. In most cases, miRISC binds to target mRNAs leading to mRNA degradation or repression of protein translation (88, 89).

5. miRNAs as modulators of TLR mediated response

Emerging pieces of evidence implicated the regulatory role of miRNA in biological and pathological processes including innate and adaptive immune responses (90). Although aberrant alterations in miRNA function are associated with the pathogenesis and progression of multiple human diseases (91-94). Several studies indicated that miRNAs act as a key component of the complex immunoregulatory networks via modulating the expression of TLRs and multiple components of TLR-signaling pathways including signaling proteins, regulatory molecules, transcription factors, and cytokines (95, 96). Here we selectively highlighted a few miRNAs in context to their regulatory functions on TLR-signaling (Tables 1-2, Figure 1).

Table 1. The regulatory role of miRNA in TLR signaling pathway in Inflammatory diseases
mRNASeed sequenceChromosome locationTarget Targets /Signaling molecules/pathway References
hsa-miR-19aaguuuugcauaguugcacuacachr13: 91350891-91350972 [+]TLR2 ↓IL6 & MMP397
hsa-miR--19bugugcaaauccaugcaaaacugachrX: 134169671-134169766 [-]TLR2↓IL6 & MMP397
hsa-miR-105 ucaaaugcucagacuccugugguchrX: 152392219-152392299 [-]TLR2 & TLR4 ↓IL6 & TNFα98
hsa-miR-146a ugagaacugaauuccauggguuchr5: 160485352-160485450 [+]TLR2, TLR4 ↓ IL1, IRAK1, TNFα/NFkB99, 117, 116, 118
hsa-miR-143 ggugcagugcugcaucucugguchr5: 149428918-149429023 [+]TLR2 ↓CD44, KLF5, & BRAF100
hsa-miR-195 uagcagcacagaaauauuggcchr17: 7017615-7017701 [-]TLR2 ↓IL-1β, IL-6 & TNFα104
rno-miR-26auucaaguaauccaggauaggcuchr8: 127714441-127714530 [+]TLR3 ↓IFNβ & TNFα107
mmu-miR-223 cguguauuugacaagcugaguugchrX: 96242817-96242926 [+]TLR3 ↓IL-1β, MCP-1, IL-8 & IL-18109
gga-miR-155 rno-miR-26auuaaugcuaaucgugauaggggchr1: 102485099-102485161 [+]TLR3 ↓IFN-β108
hsa-miR-let7iugagguaguaguuugugcuguuchr12: 62603686-62603769 [+]TLR4 ↓MyD88/NF-kappaB, Ikk2110, 111
hsa-miR-let7dagagguaguagguugcauaguuchr9: 94178834-94178920 [+]TLR4 ↓SNAP23111
hsa-miR-let-7fugagguaguagauuguauaguuchrX: 53557192-53557274 [-]TLR4 ↓SNAP23111
hsa-miR-Let7eugagguaggagguuguauaguuchr19: 51692786-51692864 [+]TLR4 ↓SNAP23111, 112
hsa-miR-98ugagguaguaaguuguauuguuchrX: 53556223-53556341 [-]TLR4 ↓SNAP23111, 112
hsa-miR-223-3P cguguauuugacaagcugaguuchrX: 66018870-66018979 [+]TLR4 ↓IL-6, IL-β, TNFα/NFkB/STAT3114, 115
hsa-miR-2909guuagggccaacaucucuuggchr17: 37033745-37033813 [+]TLR2/TLR4 ↓IL-6, IL-β, TNFα/NFkB/STAT3114
hsa-miR-511gugucuuuugcucugcaguca chr10: 17845107-17845193 [+]TLR4 ↓119
mmu-miR-21auagcuuaucagacugauguugachr11: 86584067-86584158 [-]TLR4 ↓IL-6, NF-kB/MY-88/PDCD4120
hsa-miR-21uagcuuaucagacugauguugachr17: 59841266-59841337 [+]TLR4 ↓IRAK3 & CXCL10122, 121 123
mmu-miR-100-5paacccguagauccgaacuugugchr9: 41531425-41531504 [+]TLR4 ↓Il6, Ptgs1/2123
hsa-miR-150-5pucucccaacccuuguaccagugchr19: 49500785-49500868 [-]TLR7 ↓IFN-β & IFN-α126
hsa-miR-152-5pagguucugugauacacuccgacuchr17: 48037161-48037247 [-]TLR7 ↓IFN-β & IFN-α126
hsa-miR-375-5pgcgacgagccccucgcacaaaccchr2: 219001645-219001708 [-]TLR7 ↓IFN-β & IFN-α126
let-7bugagguaguagguugugugguuchr22: 46113686-46113768 [+]TLR-7 ↓TNF-α / My88/TRPA130, 131
hsa-miR-21uagcuuaucagacugauguugachr17: 59841266-59841337 [+]TLR7/TLR8 ↓IL-6, TNF-α28
mmu-miR-21auagcuuaucagacugauguugachr11: 86584067-86584158 [-]TLR7 ↓c-jun_N-terminal kinase128
hsa-miR-29aacugauuucuuuugguguucagchr7: 130876747-130876810 [-]TLR7/TLR8 ↓IL-6, TNF-α28
mmu-miR-29aacugauuucuuuugguguucagchr6: 31062660-31062747 [-]TLR7/TLR8 ↓IL-6, TNF-α/NF-kB129
kshv-miR-K12-12aaccaggccaccauuccucuccgKSU75698: 117674-117771 [-]TLR8 ↓IL-6 & IL-10140
kshv-miR-K12-10bugguguuguccccccgaguggcTLR-8 ↓IL-6 & IL-10140
Table 2. The regulatory effect of TLR and Cytokines on miRNA in inflammatory diseases
InducerTLRsmiRNASignaling MoleculeSignaling pathwayReference
TLR2miR-155↑SHIP1 ↓TLR2/MY88/PI3K & MAPKs/NF-kB145
TLR3miR- 155 ↑IFN-β ↑TLR3/TRIF/AKT146
IL-10TLR4miR- 155↓SHIP ↑STAT3147
TLR7miR-155 ↑ miR-155* ↑TAB2↓ IRAKM ↓c-jun N-terminal kinase 148
IL-10/TGFβTLR3155↓IRF-3/NF-kB149
IL-10miR-155↓ETS2↓150
IFN-βmiR-155↑MY88/TRIF/JNK pathway151
TNF-αmiR-155↑IL6-JAK2_STAT3↓152
IFN-γ & TNF-α miR-155↑PD-L1↓153
TNF-αmiR-155↑SOCS1↓SAPK/JNK80
PregesteroneTLR4miR-155↓SOCS↑156
SEBmiR-155↑SOCS1↓157
Ikk16155↓IL-6, TNF-α↓158
hypothermiamiR-155↑IL-10, SHIP1, SOCS1↓159
Angp1miR-146b-5p ↑IRAK1& TRAF6↓166
HMGB1TLR2miR-155Ets1↓TLR2-My88162
LPSTLR4let7e↑ miR181c↑ miR-155 ↓ miR-125b ↓SOCS1↓113
Foxo3amiR-21 ↓163
Foxo3a & Foxo1miR-145 ↑164
LPSTLR3 TLR4miR-155 ↑ADAM10, TNPO3, Nup153, LEDGF/p75 ↓161

5.1. miRNAs in the regulation of TLR2

Studies revealed that TLR2 is highly expressed by lymphocytes and plasma cells and the expression is differentially regulated by different miRNAs. Also, TLR2 along with TLR4 is highly expressed in rheumatoid arthritis patients (55). In rheumatoid fibroblast-like synoviocytes, the expression of miR-19a/b is down-regulated with the upregulation of TLR2 and inflammatory cytokines associated with TLR2 signaling including IL-6 and matrix metalloproteinase 3 (MMP3) (97). In silico analysis data predicted that miR-105 has complementarity for TLR2 mRNA, and increased expression of miR-105 downregulates the production of inflammatory cytokines in human gingival keratinocytes (98). Also, miRNA-146a (miR-146a) plays an important role in endotoxin tolerance by downregulation of interleukin-1 receptor-associated kinase 1 (IRAK-1). miR-146a has shown to be upregulated in response to bacterial lipoprotein (BLP) and bacterial stimulation in both naive and BLP-tolerised human THP-1 promonocytic cells which is associated with downregulation of TLR2, TNFα and IRAK-1(99). Similarly, miR-143 blocks the TLR2 signaling pathways in human colorectal carcinoma cells and suppresses the invasion and migration of a subset of human CRC (100). Whereas, the treatment with LPS, synthetic lipid A, IL-1β, IL-2, IL-15, IFN-γ, and TNFα induced TLR2 gene expression in murine macrophages and promoted the inflammation and atherosclerosis (101-103). A recent study demonstrated that over-expression of miR-195 is involved in THP1 macrophage polarization, which reduces the levels of TLR2 along with pro-inflammatory cytokines (IL-1β, IL-6, and TNFα), and reduces phosphorylated forms of p54 JNK, p46 JNK and p38 MAPK (104). These studies suggest that miRNA-19a/b, miRNA-105, miRNA-143, miRNA-146a, and miR-195 act as a negative regulator of TLR2 expression and inflammation.

5.2. miRNAs in the regulation of TLR3

TLR3 is known to be conserved across the taxonomic kingdom and constitutively expressed by endosomes of myeloid and monocyte-derived dendritic cells (105). Studies have shown that the upregulation of TLR3 in macrophages induces the expression of IFN-β and TNFα, and promotes pristane-induced arthritis in rats, while inhibition of TLR3 reduces the severity of the disease (106). Further studies demonstrated that miR-26a-5p downregulates the expression of TLR3 in rat macrophages, whereas administration of miR-26a- mimic leads to the suppression of TLR3 protein expression and ameliorate arthritis in PIA rats (107). miR-155 has been known to be an important regulator of TLR3 signaling. Both endogenous miR-155 and virus-encoded miR-155 ortholog can inhibit IFN-β production by targeting the t-coding sequence of TLR3 in macrophages (108). Similarly, miR-223 regulates TLR3 expression in granulocyte and regulates the inflammatory response in mice (109).

5.3. miRNAs in the regulation of TLR4

TLR4 recognizes intrinsic mediators including heat-shock proteins and high-mobility group box-1 as well as LPS of gram-negative bacteria. Initial studies involving the role of miRNAs in immune response prevailed that let7i, a member of the let7 family regulate the expression of TLR4 in human biliary epithelial cells (cholangiocytes) through post-transcriptional suppression (110). The expression of let7i is decreased via a MyD88/NF-κB dependent mechanism with increased expression of TLR4 and TLR4-IKK2-signaling promotes the SNAP23-associated vesicular exocytotic process (111). Cryptosporidium parvum infection in non-malignant human cholangiocytes induces the luminal release of exosomes from the biliary and intestinal epithelium as a part of the microbial defense with reduced expression of miRNAs including let-7i, let-7d, let-7f, let-7e, and miR-98, and an increase in phosphorylation of SNAP23. Later studies have demonstrated that the parasitic protozoan C. parvum infection or LPS stimulation reduces the expression of let7 and miR-98, and also stimulates the expression of the Src homology 2-containing protein (CIS), an important negative regulator for inflammatory cytokine signaling in cholangiocytes (112). In mouse macrophages, overexpression of let7e reduces the expression of TLR4 whereas inhibition of let7e induces the expression of TLR4 (113).

LPS treatment reduces the expression of miR-223-3P and miR-2909 in human adipose stem cells, while promotes the production of pro-inflammatory cytokines (IL-6, IL-1β, and TNFα) through TLR4/TLR2/NF-κB-signal transducer and activator of transcription (STAT)-3 signaling pathways. Also, miR-2909 regulates the expression of IL-6, IL-1β, and TNFα. STAT3 directly targets TLR4 and TLR2, and promote the production of IL-6. Similarly, TNFα promotes the expression of miR-223-3p which inhibits Stat3 and led to a negative feedback loop regulation of TNF-α secretion via the LPS/TLR2/TLR4/STAT3 signaling pathway (114). Also, miRNA-223 attenuates LPS-induced inflammation in an acute lung injury model by suppressing the TLR4/NF-κB signaling pathway (115).

miR-146a inhibits both LDL accumulation and inflammatory response by negatively regulating TLR4 and thereby inhibiting the activation of TLR4-dependent signaling pathways in macrophages (116). Moreover, miR-146a inhibits the proliferation and inflammatory response of rheumatoid arthritis or fibroblast-like synoviocytes by down-regulating the TLR4/NF-κB pathway (117). Furthermore, miR-146 directly targets IRAK1 and TRAF6, which are key adapter molecules in the TLR4/NF-κB pathway (118). Similarly, miR-511 is highly expressed in differentiating dendritic cells and macrophages and acts as a negative regulator of TLR4 (119).

miR-21 is a multifunctional RNA and overexpressed under inflammatory conditions. Studies showed that miR-21 targets pro-inflammatory protein PDCD4 and acts as a negative regulator of TLR4 in LPS-treated mouse murine macrophage (120). In primary human lung cancer cells, LPS treatment increases the expression of miR-21 which promotes TLR4 and reactive oxygen species expression (121). In human lung transplants, miR-21 causes severe pathogenesis of primary graft dysfunction through the TLR4-signaling pathway (122). miR-100-5p was found to be expressed in follicular dendritic cells. Inhibition of miR-100-5p significantly enhanced expression of IL6, Ptgs1/2, and TLR4 mRNA in dendritic cells suggesting an indirect role of miR-100-5p in TLR4 signaling (123).

5.4. miRNAs in the regulation of TLR7 and TLR8

Besides the role of cellular miRNAs in TLR signaling, recent reports established an intriguing role of extracellular miRNAs in the binding and activation of intracellular TLRs (124). TLR7 recognizes viral RNA following endocytosis, an immune response, that is characterized by Type I IFN and pro-inflammatory cytokine production, whereas reduced expression of TLR7 is associated with a poor response to IFNs (125). In severe asthma, TLR7 deficiency is associated with elevated expression of miR-150-5p, mir-152-5p, and miR-375-5p in alveolar macrophages. Ex vivo knockdown of these microRNAs restored TLR7 expression with an increased IFN response to the virus (126). An elevated level of let-7b from the cerebrospinal fluid (CSF) from individuals with Alzheimer's disease activates the TLR7 and induces neurodegeneration in mice model (30). In a breast cancer mouse model, the specific delivery of let-7b efficiently reprogrammed the functions of tumor-associated macrophages (TAMs) and tumor-infiltrating dendritic cells (TIDCs), reversed the suppressive tumor microenvironment, and inhibited tumor growth by acting as a TLR-7 agonist and suppressing IL-10 production (127).

Other studies showed that tumor-secreted miR-21 and miR-29a bind as ligands to murine TLR7 and human TLR8, in immune cells, triggering a TLR-mediated pro-metastatic inflammatory response that leads to tumor growth and metastasis (28). miR-21 was also demonstrated to induce myoblast apoptosis in cancer cachexia via a TLR7-c-Jun N-terminal kinase-dependent pathway (128). In a mouse model of Acute graft-versus-host disease showed that the circulating extracellular miR-29a activates dendritic cells via TLR7 and TLR8, resulting in the activation of the NF-κB pathway and secretion of proinflammatory cytokines TNFα and IL-6 (129). Moreover, miR-21 released from the synovial tissue mediates knee OA pain through TLR7 activation in the surgical OA rat model (130).

Interestingly, in dorsal root ganglion (DRG) neurons, the extracellular let-7b couples with TRPA1 ion channel and support rapid excitation of nociceptor neurons via TLR7 and induces rapid inward currents and action potentials (131). The let-7b coupling with TRPA1 requires a core GU-rich motif (GUUGUGU motif), similar to HIV ssRNA40 (132). The GU-rich motif is required to bind to both TLR7 and TLR8 (133-136). Moreover, the GU-rich motifs also contribute to the immune stimulation, and modification of this motif is an effective mechanism in preventing immune stimulation of endogenous miR-122 (137, 138).

During viral infection, viral miRNAs can also activate pro-inflammatory cytokines through TLR pathways. Studies showed that TLR8 signaling stimulates monocytes to express type I interferon and cytokines and promotes CD4+ T helper 1 (TH1) cell differentiation, whereas TLR7 signaling promotes the production of cytokines and induces TH17 cell differentiation (139). DNA virus-encoded miRNAs (e.g., KSHV-miR-K-10b, KSHV-miR-K12-12) are involved in sepsis by interacting with TLR8 as agonists and promote the secretion of IL-6 and IL10 that leads to increased inflammation and subsequent immunosuppression (140, 141). Epstein-Barr virus infection has been associated with the development of a variety of human malignancies, including several types of lymphoma, lymphoproliferative disorder, and nasopharyngeal carcinoma (142). Viral miRNA BHRF1-1 is expressed significantly higher in plasma of patients with chronic lymphocytic leukemia (CLL), and BHRF1-1 expression in B cells of patients with CLL causes a shorter overall survival rate (143, 144).

5.5. TLR-signaling in the regulation of miRNAs

Various studies have demonstrated that both TLRs and miRNA are differentially express and interdependent in the regulation of pathogenic infection, endotoxin sensitivity, and tolerance in the innate immune system. The pathogenic gram-negative bacteria, Francisella, is recognized on the host cell surface by TLR2, recruiting the adaptor protein MyD88, and activating MAPKs, PI3K, and Akt pathways, which leads to enhanced NF-κB activity, inflammatory cytokine production, as a part of an effective host response. Src homology 2 domain-containing inositol polyphosphate-5-phosphatase 1 (SHIP1) acts as a critical modulator and negatively regulates the activation of Akt to prevent effective host response. During Francisella infection, miR-155 is induced through the TLR signaling pathway, in turn, down-regulates SHIP1 to promote the activation of the PI3K/Akt pathway and inflammatory cytokine production in human monocytes (145). Also in macrophages infected with Leishmania RNA virus 1 (LRV1), miR-155 expression is dependent on TLR-3/TRIF signaling which enhances macrophage survival through Akt activation (146). In immortalized bone marrow-derived macrophages, IL-10 inhibits TLR-induced expression of miR-155 from the BIC gene in a STAT3-dependent manner leading to the elevated expression of SHIP1 (147). Similarly, in human plasmacytoid dendritic cells, TLR7 induces the expression of miR-155 through the c-Jun N-terminal kinase pathway. miR-155 augmented interferon-α/β expression by suppressing IRAKM, whereas miR-155 inhibited their expression by targeting TAB2. Both were inversely regulated by autocrine/paracrine type I interferon and TLR7-activated KHSRP at the posttranscriptional level (148).

In non-parenchymal liver cells (NPCs), IL-10 or TGF-β potently reduces the expression of TLR3 and TLR3 dependent miR-155 expressions and suppression of the transcription factors IRF-3 and NF-κB which regulate antiviral and inflammatory activity (149). IL-10 also suppresses Ets2 expression which is a TLR regulated gene and thereby inhibits the induction of miR-155 by LPS (150). In primary murine macrophages, treatment with polyriboinosinic:cpolyribocytidylic (16) acid or the cytokine IFN-β, miR-155 is substantially up-regulated through several TLR ligands including myeloid differentiation factor 88- or TRIF-dependent pathways. miR-155-induce signals through the JNK pathway (151). Studies have shown that in rheumatoid synovial fibroblasts, TNF-α stimulation induces the expression of miR-155 and inhibits IL-6-mediated JAK2/STAT3 activation (152). Similarly, treatment of human dermal lymphatic endothelial cells (HDLECs) and dermal fibroblast with the pro-inflammatory cytokines IFN-γ and TNFα synergistically up-regulated miR-155 expressions which suppresses the programmed death ligand-1 (PD-L1) expression (153). The serum TNFα and miR-155-5p are upregulated in patients with subacute thyroiditis. TNFα inhibits proliferation and induce apoptosis of rat thyroid follicle FRTL-5 cells through modulating the IL-6-JAK2/STAT3 pathway and miR-155-5p signaling (154). TNFα negatively regulates ectopic bone formation by regulating BMP signaling. Study in MC3T3-E1 cells showed that TNFα is up-regulated miR-155 expression, whereas knockdown of miR-155 partially mitigated the inhibition of TNFα on BMP-2-induced osteogenic differentiation (155). TNFα dependent osteogenic differentiation is through SOCS1 and the SAPK/JNK pathway. Similarly, progesterone can inhibit TLR4 dependent immune response and down-regulates LPS- and poly(I:C)-induced miR-155 expression in macrophages which inhibits TLR-induced IL-6 and IFN-β via increased SOCS1 expression (156).

Studies have demonstrated that Staphylococcal enterotoxin B (SEB) inhalation results in acute inflammatory lung injury with overexpression of miR-155 and IFNγ, whereas suppression of SOCS1 (157). Similarly, IκK-16 treatment of primary human monocytes decreases miR-155 expression and decreases the secretion of TNFα and IL-10, ultimately attenuates the monocyte inflammatory response (158). Moreover, hypothermia induces an increase in miR-155 expression and reduced production of IL-10, Ship1, and SOCS1 while the expression of proinflammatory cytokines is increased in monocytes and macrophages (159). In ischemia-induced cerebral inflammation, miR-155 promotes TNFα and IL-1β expression through TLR4 expression and inhibition of MyD88 and SOCS1 expression (160). Another study revealed that stimulation of monocyte-derived macrophages reduces their susceptibility to HIV-1 infection through TLR3 or TLR4 by inducing the expression of miR-155 (161). The nuclear protein HMGB1 induces the TLR2 mediated and MyD88-dependent upregulation of miR-155 with a decreased expression of Ets-1 during double-stranded antibody induction involved in the pathogenesis of SLE (162).

Studies are further demonstrated that LPS dependent activation of protein kinase Akt1 promotes miRNAs let-7e and miR-181c expressions, whereas downregulate miR-155 and miR-125b. Both miRNA and TLRs are differentially regulated with interdependent manner such as Let-7e repress TLR4, whereas miR-155 repress SOCS1 (113). Several other transcription factors such as Foxo3a regulates apoptosis by negatively targeting miR-21, whereas Foxo1 and Foxo3a positively regulate miR-145 in renal tumor development (163-164). miR-145 serves as a key component of the Foxo-Mxi1-SRα/miR-145 axis as a major inhibitor of renal tumor development. Similarly, miRNA-27b-3p and miRNA-455-3p promote cancer cell quiescence by facilitating the stabilization of p27 (165). Another study showed that angiopoietin-1 (Ang-1) disrupts TLR4 signaling with inhibition of LPS-induced inflammatory responses in endothelial cells through selective targeting of IRAK1 and TRAF6 proteins by miR-146b-5p (166).

Studies also implicated that TLR4 is up-regulated in LPS-treated human polymorphonuclear neutrophils (PMN) and monocytes and induces the transcription of miR-9 in a MyD88- and NF-kB-dependent manner. miR-9 is also induced by TLR2 and TLR7/8 agonists and by the proinflammatory cytokines TNF-α and IL-1β, but not by IFN-γ (Bazzoni et al, 2009). Also, miR-147 was induced upon stimulation of multiple TLRs (TLR2/3 and 4) in LPS-treated murine macrophages while stimulation of TLR4 was more effective in inducing miR-147 expression. TLR4-induced miR-147 expression needs activation of both NF-κB and IRF3 to prevent excessive inflammatory responses (Liu et al, 2009; 19721002).

6. Conclusions

TLRs are the key innate immune PRRs and are tightly regulated system to ensure a host immune response to foreign invaders. At present, our understanding of the complex biology of the miRNAs in innate immunity is limited and functional studies remain a work in progress. We have provided some of the experimental shreds of evidence supporting a conserved role for the miRNAs in TLR-signaling or vise-versa. However, the individual miRNAs are likely to have functionally different effects compared to the TLRs, since a single miRNA may have overlapping functions in modulating gene expression. Moreover, miRNAs regulate TLR signaling at different levels by targeting multiple molecules involved in the TLR pathway, such as the expression of TLRs themselves, TLR recruited adaptor molecules, TLR-induced signaling cascade proteins, transcription factors, and even the pro-inflammatory cytokines of TLR signaling. Both intracellular and extracellular miRNAs can modulate TLR signaling pathways mainly either through their involvement via transcriptional regulation or serving as physiological ligands of TLRs. Given that crosstalk between the miRNAs and TLR signaling pathways suggesting further studies are needed for designing new therapies that target specific signaling pathways which could restore the adequate immune response necessary to address an invading pathogen.

7. Acknowledgments

This study was supported in part by National Institutes of Health Grants 1SC3 GM113751, U54 MD007602 and G12-MD007602. This investigation was conducted in a facility constructed with support from Research Facilities Improvement Grant #C06 RR018386 from NIH/NCRR.

Abbreviations: AP1: activator protein-1; AGO: argonaute; BLP: bacterial lipoprotein; CSF: cerebrospinal fluid; DAMPs: damage-associated molecular patterns; DGCR8: Drosha and the DiGeorge critical region 8 protein; HBV: hepatitis B virus; IL: interleukin; IRAK-1: interleukin-1 receptor-associated kinase 1; LRR: leucine-rich repeat region; LPS: lipopolysaccharide; MMP3: matrix metalloproteinase 3; miRNAs: MicroRNAs; miRISC: miRNA-induced silencing complex; MAPK: mitogen-associated protein kinase; MyD88: Myeloid differentiation primary response gene 88; NF-κB: nuclear factor kappa-light-chain-enhancer of activated B cells; PAMPs: pathogen-associated molecular patterns; pri-miRNAs: primary miRNAs; RA: rheumatoid arthritis; SHIP1: Src homology 2 domain-containing inositol polyphosphate-5-phosphatase 1; SARM: Sterile α- and armadillo-motif-containing protein; SLE: systemic lupus erythematosus; TH1: T helper 1; TIRAP or MAL: TIR domain-containing adaptor protein; TRIF: TIR domain-containing adaptor protein inducing IFN-β; TIR: Toll/Interleukin-1 (IL-1) receptor; TLRs: Toll-like receptors; TRAM: TRIF-related adaptor molecule; TNF-α: tumor necrosis factor-alpha; TAMs: tumor-associated macrophages; TIDCs: tumor-infiltrating dendritic cells; UTR: untranslated region
References

    1. D. D. Chaplin: Overview of the immune response. J Allergy Clin Immunol, 125(2 Suppl 2), S3-23 (2010)

    2. S. Akira and K. Takeda: Toll-like receptor signalling. Nat Rev Immunol, 4(7), 499-511 (2004)

    3. T. Kawai and S. Akira: TLR signaling. Semin Immunol, 19(1), 24-32 (2007)

    4. K. Elward and P. Gasque: "Eat me" and "don't eat me" signals govern the innate immune response and tissue repair in the CNS: emphasis on the critical role of the complement system. Mol Immunol, 40(2-4), 85-94 (2003)

    5. K. Takeda, T. Kaisho and S. Akira: Toll-like receptors. Annu Rev Immunol, 21, 335-76 (2003)

    6. T. Kawai and S. Akira: The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat Immunol, 11(5), 373-84 (2010)

    7. J. K. Bell, G. E. Mullen, C. A. Leifer, A. Mazzoni, D. R. Davies and D. M. Segal: Leucine-rich repeats and pathogen recognition in Toll-like receptors. Trends Immunol, 24(10), 528-33 (2003)

    8. K. Singh, S. Kant, V. K. Singh, N. K. Agrawal, S. K. Gupta and K. Singh: Toll-like receptor 4 polymorphisms and their haplotypes modulate the risk of developing diabetic retinopathy in type 2 diabetes patients. Mol Vis, 20, 704-13 (2014)

    9. T. Kawai and S. Akira: Toll-like receptors and their crosstalk with other innate receptors in infection and immunity. Immunity, 34(5), 637-50 (2011)

    10. Y. Wang, E. Song, B. Bai and P. M. Vanhoutte: Toll-like receptors mediating vascular malfunction: Lessons from receptor subtypes. Pharmacol Ther, 158, 91-100 (2016)

    11. M. Yamamoto and K. Takeda: Current views of toll-like receptor signaling pathways. Gastroenterol Res Pract, 2010, 240365 (2010)

    12. N. J. Gay, M. F. Symmons, M. Gangloff and C. E. Bryant: Assembly and localization of Toll-like receptor signalling complexes. Nat Rev Immunol, 14(8), 546-58 (2014)

    13. G. Sellge and T. A. Kufer: PRR-signaling pathways: Learning from microbial tactics. Semin Immunol, 27(2), 75-84 (2015)

    14. A. F. McGettrick and L. A. O'Neill: Localisation and trafficking of Toll-like receptors: an important mode of regulation. Curr Opin Immunol, 22(1), 20-7 (2010)

    15. T. Oosenbrug, M. J. van de Graaff, M. E. Ressing and S. I. van Kasteren: Chemical Tools for Studying TLR Signaling Dynamics. Cell Chem Biol, 24(7), 801-812 (2017)

    16. M. Matsumoto and T. Seya: TLR3: interferon induction by double-stranded RNA including poly(I:C). Adv Drug Deliv Rev, 60(7), 805-12 (2008)

    17. Y. Delneste, C. Beauvillain and P. Jeannin: [Innate immunity: structure and function of TLRs]. Med Sci (Paris), 23(1), 67-73 (2007)

    18. K. A. Zarember and P. J. Godowski: Tissue expression of human Toll-like receptors and differential regulation of Toll-like receptor mRNAs in leukocytes in response to microbes, their products, and cytokines. J Immunol, 168(2), 554-61 (2002)

    19. G. A. Calin, C. G. Liu, C. Sevignani, M. Ferracin, N. Felli, C. D. Dumitru, M. Shimizu, A. Cimmino, S. Zupo, M. Dono, M. L. Dell'Aquila, H. Alder, L. Rassenti, T. J. Kipps, F. Bullrich, M. Negrini and C. M. Croce: MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias. Proc Natl Acad Sci U S A, 101(32), 11755-60 (2004)

    20. G. Di Leva, M. Garofalo and C. M. Croce: MicroRNAs in cancer. Annu Rev Pathol, 9, 287-314 (2014)

    21. M. Fabbri, A. Paone, F. Calore, R. Galli and C. M. Croce: A new role for microRNAs, as ligands of Toll-like receptors. RNA Biol, 10(2), 169-74 (2013)

    22. A. Mehta and D. Baltimore: MicroRNAs as regulatory elements in immune system logic. Nat Rev Immunol, 16(5), 279-94 (2016)

    23. E. van Rooij and E. N. Olson: MicroRNA therapeutics for cardiovascular disease: opportunities and obstacles. Nat Rev Drug Discov, 11(11), 860-72 (2012)

    24. D. P. Bartel: MicroRNAs: target recognition and regulatory functions. Cell, 136(2), 215-33 (2009)

    25. M. R. Fabian, N. Sonenberg and W. Filipowicz: Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem, 79, 351-79 (2010)

    26. C. Z. Chen, S. Schaffert, R. Fragoso and C. Loh: Regulation of immune responses and tolerance: the microRNA perspective. Immunol Rev, 253(1), 112-28 (2013)

    27. R. Bayraktar, M. Pichler, P. Kanlikilicer, C. Ivan, E. Bayraktar, N. Kahraman, B. Aslan, S. Oguztuzun, M. Ulasli, A. Arslan, G. Calin, G. Lopez-Berestein and B. Ozpolat: MicroRNA 603 acts as a tumor suppressor and inhibits triple-negative breast cancer tumorigenesis by targeting elongation factor 2 kinase. Oncotarget, 8(7), 11641-11658 (2017)

    28. M. Fabbri, A. Paone, F. Calore, R. Galli, E. Gaudio, R. Santhanam, F. Lovat, P. Fadda, C. Mao, G. J. Nuovo, N. Zanesi, M. Crawford, G. H. Ozer, D. Wernicke, H. Alder, M. A. Caligiuri, P. Nana-Sinkam, D. Perrotti and C. M. Croce: MicroRNAs bind to Toll-like receptors to induce prometastatic inflammatory response. Proc Natl Acad Sci U S A, 109(31), E2110-6 (2012)

    29. V. Gonzalez-Villasana, M. H. Rashed, Y. Gonzalez-Cantu, R. Bayraktar, J. L. Menchaca-Arredondo, J. M. Vazquez-Guillen, C. Rodriguez-Padilla, G. Lopez-Berestein and D. Resendez-Perez: Presence of Circulating miR-145, miR-155, and miR-382 in Exosomes Isolated from Serum of Breast Cancer Patients and Healthy Donors. Dis Markers, 2019, 6852917 (2019)

    30. S. M. Lehmann, C. Kruger, B. Park, K. Derkow, K. Rosenberger, J. Baumgart, T. Trimbuch, G. Eom, M. Hinz, D. Kaul, P. Habbel, R. Kalin, E. Franzoni, A. Rybak, D. Nguyen, R. Veh, O. Ninnemann, O. Peters, R. Nitsch, F. L. Heppner, D. Golenbock, E. Schott, H. L. Ploegh, F. G. Wulczyn and S. Lehnardt: An unconventional role for miRNA: let-7 activates Toll-like receptor 7 and causes neurodegeneration. Nat Neurosci, 15(6), 827-35 (2012)

    31. M. H. Rashed, P. Kanlikilicer, C. Rodriguez-Aguayo, M. Pichler, R. Bayraktar, E. Bayraktar, C. Ivan, J. Filant, A. Silva, B. Aslan, M. Denizli, R. Mitra, B. Ozpolat, G. A. Calin, A. K. Sood, M. F. Abd-Ellah, G. K. Helal and G. L. Berestein: Exosomal miR-940 maintains SRC-mediated oncogenic activity in cancer cells: a possible role for exosomal disposal of tumor suppressor miRNAs. Oncotarget, 8(12), 20145-20164 (2017)

    32. M. L. Squadrito, C. Baer, F. Burdet, C. Maderna, G. D. Gilfillan, R. Lyle, M. Ibberson and M. De Palma: Endogenous RNAs modulate microRNA sorting to exosomes and transfer to acceptor cells. Cell Rep, 8(5), 1432-46 (2014)

    33. F. Olivieri, M. R. Rippo, F. Prattichizzo, L. Babini, L. Graciotti, R. Recchioni and A. D. Procopio: Toll like receptor signaling in "inflammaging": microRNA as new players. Immun Ageing, 10(1), 11 (2013)

    34. K. Hoebe, X. Du, P. Georgel, E. Janssen, K. Tabeta, S. O. Kim, J. Goode, P. Lin, N. Mann, S. Mudd, K. Crozat, S. Sovath, J. Han and B. Beutler: Identification of Lps2 as a key transducer of MyD88-independent TIR signalling. Nature, 424(6950), 743-8 (2003)

    35. H. Kumar, T. Kawai and S. Akira: Pathogen recognition in the innate immune response. Biochem J, 420(1), 1-16 (2009)

    36. J. S. Ayres and D. S. Schneider: Tolerance of infections. Annu Rev Immunol, 30, 271-94 (2012)

    37. C. C. Lee, A. M. Avalos and H. L. Ploegh: Accessory molecules for Toll-like receptors and their function. Nat Rev Immunol, 12(3), 168-79 (2012)

    38. C. A. Leifer and A. E. Medvedev: Molecular mechanisms of regulation of Toll-like receptor signaling. J Leukoc Biol, 100(5), 927-941 (2016)

    39. I. Botos, D. M. Segal and D. R. Davies: The structural biology of Toll-like receptors. Structure, 19(4), 447-59 (2011)

    40. M. Carty, R. Goodbody, M. Schroder, J. Stack, P. N. Moynagh and A. G. Bowie: The human adaptor SARM negatively regulates adaptor protein TRIF-dependent Toll-like receptor signaling. Nat Immunol, 7(10), 1074-81 (2006)

    41. E. F. Kenny and L. A. O'Neill: Signalling adaptors used by Toll-like receptors: an update. Cytokine, 43(3), 342-9 (2008)

    42. R. Barbalat, L. Lau, R. M. Locksley and G. M. Barton: Toll-like receptor 2 on inflammatory monocytes induces type I interferon in response to viral but not bacterial ligands. Nat Immunol, 10(11), 1200-7 (2009)

    43. E. Faure, O. Equils, P. A. Sieling, L. Thomas, F. X. Zhang, C. J. Kirschning, N. Polentarutti, M. Muzio and M. Arditi: Bacterial lipopolysaccharide activates NF-kappaB through toll-like receptor 4 (TLR-4) in cultured human dermal endothelial cells. Differential expression of TLR-4 and TLR-2 in endothelial cells. J Biol Chem, 275(15), 11058-63 (2000)

    44. C. A. Janeway, Jr. and R. Medzhitov: Innate immune recognition. Annu Rev Immunol, 20, 197-216 (2002)

    45. M. S. Jin and J. O. Lee: Structures of the toll-like receptor family and its ligand complexes. Immunity, 29(2), 182-91 (2008)

    46. A. Mansell, E. Brint, J. A. Gould, L. A. O'Neill and P. J. Hertzog: Mal interacts with tumor necrosis factor receptor-associated factor (TRAF)-6 to mediate NF-kappaB activation by toll-like receptor (TLR)-2 and TLR4. J Biol Chem, 279(36), 37227-30 (2004)

    47. N. J. Bernard and L. A. O'Neill: Mal, more than a bridge to MyD88. IUBMB Life, 65(9), 777-86 (2013)

    48. A. F. McGettrick, E. K. Brint, E. M. Palsson-McDermott, D. C. Rowe, D. T. Golenbock, N. J. Gay, K. A. Fitzgerald and L. A. O'Neill: Trif-related adapter molecule is phosphorylated by PKC{epsilon} during Toll-like receptor 4 signaling. Proc Natl Acad Sci U S A, 103(24), 9196-201 (2006)

    49. C. Couillault, N. Pujol, J. Reboul, L. Sabatier, J. F. Guichou, Y. Kohara and J. J. Ewbank: TLR-independent control of innate immunity in Caenorhabditis elegans by the TIR domain adaptor protein TIR-1, an ortholog of human SARM. Nat Immunol, 5(5), 488-94 (2004)

    50. T. D. Troutman, W. Hu, S. Fulenchek, T. Yamazaki, T. Kurosaki, J. F. Bazan and C. Pasare: Role for B-cell adapter for PI3K (BCAP) as a signaling adapter linking Toll-like receptors (TLRs) to serine/threonine kinases PI3K/Akt. Proc Natl Acad Sci U S A, 109(1), 273-8 (2012)

    51. N. W. Palm and R. Medzhitov: Pattern recognition receptors and control of adaptive immunity. Immunol Rev, 227(1), 221-33 (2009)

    52. P. Broz and D. M. Monack: Newly described pattern recognition receptors team up against intracellular pathogens. Nat Rev Immunol, 13(8), 551-65 (2013)

    53. X. He, Z. Jing and G. Cheng: MicroRNAs: new regulators of Toll-like receptor signalling pathways. Biomed Res Int, 2014, 945169 (2014)

    54. K. Newton and V. M. Dixit: Signaling in innate immunity and inflammation. Cold Spring Harb Perspect Biol, 4(3) (2012)

    55. Q. Q. Huang and R. M. Pope: The role of toll-like receptors in rheumatoid arthritis. Curr Rheumatol Rep, 11(5), 357-64 (2009)

    56. I. Jialal, H. Kaur and S. Devaraj: Toll-like receptor status in obesity and metabolic syndrome: a translational perspective. J Clin Endocrinol Metab, 99(1), 39-48 (2014)

    57. J. M. Isaza-Correa, Z. Liang, A. van den Berg, A. Diepstra and L. Visser: Toll-like receptors in the pathogenesis of human B cell malignancies. J Hematol Oncol, 7, 57 (2014)

    58. S. Devaraj, J. M. Yun, C. R. Duncan-Staley and I. Jialal: Low vitamin D levels correlate with the proinflammatory state in type 1 diabetic subjects with and without microvascular complications. Am J Clin Pathol, 135(3), 429-33 (2011)

    59. L. A. O'Neill: When signaling pathways collide: positive and negative regulation of toll-like receptor signal transduction. Immunity, 29(1), 12-20 (2008)

    60. T. Kondo, T. Kawai and S. Akira: Dissecting negative regulation of Toll-like receptor signaling. Trends Immunol, 33(9), 449-58 (2012)

    61. J. J. Forman, A. Legesse-Miller and H. A. Coller: A search for conserved sequences in coding regions reveals that the let-7 microRNA targets Dicer within its coding sequence. Proc Natl Acad Sci U S A, 105(39), 14879-84 (2008)

    62. J. Zhang, W. Zhou, Y. Liu, T. Liu, C. Li and L. Wang: Oncogenic role of microRNA-532-5p in human colorectal cancer via targeting of the 5'UTR of RUNX3. Oncol Lett, 15(5), 7215-7220 (2018)

    63. E. V. Makeyev and T. Maniatis: Multilevel regulation of gene expression by microRNAs. Science, 319(5871), 1789-90 (2008)

    64. A. Rebane and C. A. Akdis: MicroRNAs: Essential players in the regulation of inflammation. J Allergy Clin Immunol, 132(1), 15-26 (2013)

    65. A. Dharap, C. Pokrzywa, S. Murali, G. Pandi and R. Vemuganti: MicroRNA miR-324-3p induces promoter-mediated expression of RelA gene. PLoS One, 8(11), e79467 (2013)

    66. F. Bullrich, H. Fujii, G. Calin, H. Mabuchi, M. Negrini, Y. Pekarsky, L. Rassenti, H. Alder, J. C. Reed, M. J. Keating, T. J. Kipps and C. M. Croce: Characterization of the 13q14 tumor suppressor locus in CLL: identification of ALT1, an alternative splice variant of the LEU2 gene. Cancer Res, 61(18), 6640-8 (2001)

    67. M. Fabbri, R. Garzon, M. Andreeff, H. M. Kantarjian, G. Garcia-Manero and G. A. Calin: MicroRNAs and noncoding RNAs in hematological malignancies: molecular, clinical and therapeutic implications. Leukemia, 22(6), 1095-105 (2008)

    68. P. Kanlikilicer, M. H. Rashed, R. Bayraktar, R. Mitra, C. Ivan, B. Aslan, X. Zhang, J. Filant, A. M. Silva, C. Rodriguez-Aguayo, E. Bayraktar, M. Pichler, B. Ozpolat, G. A. Calin, A. K. Sood and G. Lopez-Berestein: Ubiquitous Release of Exosomal Tumor Suppressor miR-6126 from Ovarian Cancer Cells. Cancer Res, 76(24), 7194-7207 (2016)

    69. R. Munker and G. A. Calin: MicroRNA profiling in cancer. Clin Sci (Lond), 121(4), 141-58 (2011)

    70. C. Sevignani, G. A. Calin, S. C. Nnadi, M. Shimizu, R. V. Davuluri, T. Hyslop, P. Demant, C. M. Croce and L. D. Siracusa: MicroRNA genes are frequently located near mouse cancer susceptibility loci. Proc Natl Acad Sci U S A, 104(19), 8017-22 (2007)

    71. L. A. Macfarlane and P. R. Murphy: MicroRNA: Biogenesis, Function and Role in Cancer. Curr Genomics, 11(7), 537-61 (2010)

    72. Y. Lee, C. Ahn, J. Han, H. Choi, J. Kim, J. Yim, J. Lee, P. Provost, O. Radmark, S. Kim and V. N. Kim: The nuclear RNase III Drosha initiates microRNA processing. Nature, 425(6956), 415-9 (2003)

    73. Y. Lee, K. Jeon, J. T. Lee, S. Kim and V. N. Kim: MicroRNA maturation: stepwise processing and subcellular localization. EMBO J, 21(17), 4663-70 (2002)

    74. M. Ballarino, F. Pagano, E. Girardi, M. Morlando, D. Cacchiarelli, M. Marchioni, N. J. Proudfoot and I. Bozzoni: Coupled RNA processing and transcription of intergenic primary microRNAs. Mol Cell Biol, 29(20), 5632-8 (2009)

    75. M. Morlando, M. Ballarino, N. Gromak, F. Pagano, I. Bozzoni and N. J. Proudfoot: Primary microRNA transcripts are processed co-transcriptionally. Nat Struct Mol Biol, 15(9), 902-9 (2008)

    76. G. Hutvagner, J. McLachlan, A. E. Pasquinelli, E. Balint, T. Tuschl and P. D. Zamore: A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science, 293(5531), 834-8 (2001)

    77. A. Grishok, A. E. Pasquinelli, D. Conte, N. Li, S. Parrish, I. Ha, D. L. Baillie, A. Fire, G. Ruvkun and C. C. Mello: Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell, 106(1), 23-34 (2001)

    78. R. F. Ketting, S. E. Fischer, E. Bernstein, T. Sijen, G. J. Hannon and R. H. Plasterk: Dicer functions in RNA interference and in synthesis of small RNA involved in developmental timing in C. elegans. Genes Dev, 15(20), 2654-9 (2001)

    79. E. Bernstein, A. A. Caudy, S. M. Hammond and G. J. Hannon: Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature, 409(6818), 363-6 (2001)

    80. M. Yoda, T. Kawamata, Z. Paroo, X. Ye, S. Iwasaki, Q. Liu and Y. Tomari: ATP-dependent human RISC assembly pathways. Nat Struct Mol Biol, 17(1), 17-23 (2010)

    81. J. O'Brien, H. Hayder, Y. Zayed and C. Peng: Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation. Front Endocrinol (Lausanne), 9, 402 (2018)

    82. J. G. Ruby, C. H. Jan and D. P. Bartel: Intronic microRNA precursors that bypass Drosha processing. Nature, 448(7149), 83-6 (2007)

    83. J. E. Babiarz, J. G. Ruby, Y. Wang, D. P. Bartel and R. Blelloch: Mouse ES cells express endogenous shRNAs, siRNAs, and other Microprocessor-independent, Dicer-dependent small RNAs. Genes Dev, 22(20), 2773-85 (2008)

    84. K. Okamura, J. W. Hagen, H. Duan, D. M. Tyler and E. C. Lai: The mirtron pathway generates microRNA-class regulatory RNAs in Drosophila. Cell, 130(1), 89-100 (2007)

    85. M. A. Havens, A. A. Reich, D. M. Duelli and M. L. Hastings: Biogenesis of mammalian microRNAs by a non-canonical processing pathway. Nucleic Acids Res, 40(10), 4626-40 (2012)

    86. M. Xie, M. Li, A. Vilborg, N. Lee, M. D. Shu, V. Yartseva, N. Sestan and J. A. Steitz: Mammalian 5'-capped microRNA precursors that generate a single microRNA. Cell, 155(7), 1568-80 (2013)

    87. J. S. Yang, T. Maurin, N. Robine, K. D. Rasmussen, K. L. Jeffrey, R. Chandwani, E. P. Papapetrou, M. Sadelain, D. O'Carroll and E. C. Lai: Conserved vertebrate mir-451 provides a platform for Dicer-independent, Ago2-mediated microRNA biogenesis. Proc Natl Acad Sci U S A, 107(34), 15163-8 (2010)

    88. E. Huntzinger and E. Izaurralde: Gene silencing by microRNAs: contributions of translational repression and mRNA decay. Nat Rev Genet, 12(2), 99-110 (2011)

    89. J. J. Ipsaro and L. Joshua-Tor: From guide to target: molecular insights into eukaryotic RNA-interference machinery. Nat Struct Mol Biol, 22(1), 20-8 (2015)

    90. G. Fu, J. Brkic, H. Hayder and C. Peng: MicroRNAs in Human Placental Development and Pregnancy Complications. Int J Mol Sci, 14(3), 5519-44 (2013)

    91. S. Lin and R. I. Gregory: MicroRNA biogenesis pathways in cancer. Nat Rev Cancer, 15(6), 321-33 (2015)

    92. F. Wang, C. Chen and D. Wang: Circulating microRNAs in cardiovascular diseases: from biomarkers to therapeutic targets. Front Med, 8(4), 404-18 (2014)

    93. S. Absalon, D. M. Kochanek, V. Raghavan and A. M. Krichevsky: MiR-26b, upregulated in Alzheimer's disease, activates cell cycle entry, tau-phosphorylation, and apoptosis in postmitotic neurons. J Neurosci, 33(37), 14645-59 (2013)

    94. E. Minones-Moyano, S. Porta, G. Escaramis, R. Rabionet, S. Iraola, B. Kagerbauer, Y. Espinosa-Parrilla, I. Ferrer, X. Estivill and E. Marti: MicroRNA profiling of Parkinson's disease brains identifies early downregulation of miR-34b/c which modulate mitochondrial function. Hum Mol Genet, 20(15), 3067-78 (2011)

    95. R. M. O'Connell, D. S. Rao, A. A. Chaudhuri and D. Baltimore: Physiological and pathological roles for microRNAs in the immune system. Nat Rev Immunol, 10(2), 111-22 (2010)

    96. L. A. O'Neill, F. J. Sheedy and C. E. McCoy: MicroRNAs: the fine-tuners of Toll-like receptor signalling. Nat Rev Immunol, 11(3), 163-75 (2011)

    97. L. Philippe, G. Alsaleh, G. Suffert, A. Meyer, P. Georgel, J. Sibilia, D. Wachsmann and S. Pfeffer: TLR2 expression is regulated by microRNA miR-19 in rheumatoid fibroblast-like synoviocytes. J Immunol, 188(1), 454-61 (2012)

    98. M. R. Benakanakere, Q. Li, M. A. Eskan, A. V. Singh, J. Zhao, J. C. Galicia, P. Stathopoulou, T. B. Knudsen and D. F. Kinane: Modulation of TLR2 protein expression by miR-105 in human oral keratinocytes. J Biol Chem, 284(34), 23107-15 (2009)

    99. E. M. Quinn, J. H. Wang, G. O'Callaghan and H. P. Redmond: MicroRNA-146a is upregulated by and negatively regulates TLR2 signaling. PLoS One, 8(4), e62232 (2013)

    100. H. Guo, Y. Chen, X. Hu, G. Qian, S. Ge and J. Zhang: The regulation of Toll-like receptor 2 by miR-143 suppresses the invasion and migration of a subset of human colorectal carcinoma cells. Mol Cancer, 12, 77 (2013)

    101. Y. Liu, Y. Wang, M. Yamakuchi, S. Isowaki, E. Nagata, Y. Kanmura, I. Kitajima and I. Maruyama: Upregulation of toll-like receptor 2 gene expression in macrophage response to peptidoglycan and high concentration of lipopolysaccharide is involved in NF-kappa b activation. Infect Immun, 69(5), 2788-96 (2001)

    102. T. Matsuguchi, T. Musikacharoen, T. Ogawa and Y. Yoshikai: Gene expressions of Toll-like receptor 2, but not Toll-like receptor 4, is induced by LPS and inflammatory cytokines in mouse macrophages. J Immunol, 165(10), 5767-72 (2000)

    103. L. Chavez-Sanchez, M. G. Garza-Reyes, J. E. Espinosa-Luna, K. Chavez-Rueda, M. V. Legorreta-Haquet and F. Blanco-Favela: The role of TLR2, TLR4 and CD36 in macrophage activation and foam cell formation in response to oxLDL in humans. Hum Immunol, 75(4), 322-9 (2014)

    104. J. P. Bras, A. M. Silva, G. A. Calin, M. A. Barbosa, S. G. Santos and M. I. Almeida: miR-195 inhibits macrophages pro-inflammatory profile and impacts the crosstalk with smooth muscle cells. PLoS One, 12(11), e0188530 (2017)

    105. D. S. O'Mahony, U. Pham, R. Iyer, T. R. Hawn and W. C. Liles: Differential constitutive and cytokine-modulated expression of human Toll-like receptors in primary neutrophils, monocytes, and macrophages. Int J Med Sci, 5(1), 1-8 (2008)

    106. L. Meng, W. Zhu, C. Jiang, X. He, W. Hou, F. Zheng, R. Holmdahl and S. Lu: Toll-like receptor 3 upregulation in macrophages participates in the initiation and maintenance of pristane-induced arthritis in rats. Arthritis Res Ther, 12(3), R103 (2010)

    107. C. Jiang, W. Zhu, J. Xu, B. Wang, W. Hou, R. Zhang, N. Zhong, Q. Ning, Y. Han, H. Yu, J. Sun, L. Meng and S. Lu: MicroRNA-26a negatively regulates toll-like receptor 3 expression of rat macrophages and ameliorates pristane induced arthritis in rats. Arthritis Res Ther, 16(1), R9 (2014)

    108. X. Hu, J. Ye, A. Qin, H. Zou, H. Shao and K. Qian: Both MicroRNA-155 and Virus-Encoded MiR-155 Ortholog Regulate TLR3 Expression. PLoS One, 10(5), e0126012 (2015)

    109. J. B. Johnnidis, M. H. Harris, R. T. Wheeler, S. Stehling-Sun, M. H. Lam, O. Kirak, T. R. Brummelkamp, M. D. Fleming and F. D. Camargo: Regulation of progenitor cell proliferation and granulocyte function by microRNA-223. Nature, 451(7182), 1125-9 (2008)

    110. X. M. Chen, P. L. Splinter, S. P. O'Hara and N. F. LaRusso: A cellular micro-RNA, let-7i, regulates Toll-like receptor 4 expression and contributes to cholangiocyte immune responses against Cryptosporidium parvum infection. J Biol Chem, 282(39), 28929-38 (2007)

    111. G. Hu, A. Y. Gong, A. L. Roth, B. Q. Huang, H. D. Ward, G. Zhu, N. F. Larusso, N. D. Hanson and X. M. Chen: Release of luminal exosomes contributes to TLR4-mediated epithelial antimicrobial defense. PLoS Pathog, 9(4), e1003261 (2013)

    112. G. Hu, R. Zhou, J. Liu, A. Y. Gong, A. N. Eischeid, J. W. Dittman and X. M. Chen: MicroRNA-98 and let-7 confer cholangiocyte expression of cytokine-inducible Src homology 2-containing protein in response to microbial challenge. J Immunol, 183(3), 1617-24 (2009)

    113. A. Androulidaki, D. Iliopoulos, A. Arranz, C. Doxaki, S. Schworer, V. Zacharioudaki, A. N. Margioris, P. N. Tsichlis and C. Tsatsanis: The kinase Akt1 controls macrophage response to lipopolysaccharide by regulating microRNAs. Immunity, 31(2), 220-31 (2009)

    114. J. Wu, P. Niu, Y. Zhao, Y. Cheng, W. Chen, L. Lin, J. Lu, X. Cheng and Z. Xu: Impact of miR-223-3p and miR-2909 on inflammatory factors IL-6, IL-1ss, and TNF-alpha, and the TLR4/TLR2/NF-kappaB/STAT3 signaling pathway induced by lipopolysaccharide in human adipose stem cells. PLoS One, 14(2), e0212063 (2019)

    115. Y. Yan, K. Lu, T. Ye and Z. Zhang: MicroRNA223 attenuates LPSinduced inflammation in an acute lung injury model via the NLRP3 inflammasome and TLR4/NFkappaB signaling pathway via RHOB. Int J Mol Med, 43(3), 1467-1477 (2019)

    116. K. Yang, Y. S. He, X. Q. Wang, L. Lu, Q. J. Chen, J. Liu, Z. Sun and W. F. Shen: MiR-146a inhibits oxidized low-density lipoprotein-induced lipid accumulation and inflammatory response via targeting toll-like receptor 4. FEBS Lett, 585(6), 854-60 (2011)

    117. W. Liu, Y. H. Wu, L. Zhang, B. Xue, Y. Wang, B. Liu, X. Y. Liu, F. Zuo, X. Y. Yang, F. Y. Chen, R. Duan, Y. Cai, B. Zhang and Y. Ji: MicroRNA-146a suppresses rheumatoid arthritis fibroblast-like synoviocytes proliferation and inflammatory responses by inhibiting the TLR4/NF-kB signaling. Oncotarget, 9(35), 23944-23959 (2018)

    118. K. D. Taganov, M. P. Boldin, K. J. Chang and D. Baltimore: NF-kappaB-dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. Proc Natl Acad Sci U S A, 103(33), 12481-6 (2006)

    119. L. Tserel, T. Runnel, K. Kisand, M. Pihlap, L. Bakhoff, R. Kolde, H. Peterson, J. Vilo, P. Peterson and A. Rebane: MicroRNA expression profiles of human blood monocyte-derived dendritic cells and macrophages reveal miR-511 as putative positive regulator of Toll-like receptor 4. J Biol Chem, 286(30), 26487-95 (2011)

    120. F. J. Sheedy, E. Palsson-McDermott, E. J. Hennessy, C. Martin, J. J. O'Leary, Q. Ruan, D. S. Johnson, Y. Chen and L. A. O'Neill: Negative regulation of TLR4 via targeting of the proinflammatory tumor suppressor PDCD4 by the microRNA miR-21. Nat Immunol, 11(2), 141-7 (2010)

    121. X. Zhang, C. Wang, S. Shan, X. Liu, Z. Jiang and T. Ren: TLR4/ROS/miRNA-21 pathway underlies lipopolysaccharide instructed primary tumor outgrowth in lung cancer patients. Oncotarget, 7(27), 42172-42182 (2016)

    122. Z. Xu, M. Sharma, A. Gelman, R. Hachem and T. Mohanakumar: Significant role for microRNA-21 affecting toll-like receptor pathway in primary graft dysfunction after human lung transplantation. J Heart Lung Transplant, 36(3), 331-339 (2017)

    123. S. R. Aungier, H. Ohmori, M. Clinton and N. A. Mabbott: MicroRNA-100-5p indirectly modulates the expression of Il6, Ptgs1/2 and Tlr4 mRNA in the mouse follicular dendritic cell-like cell line, FL-Y. Immunology, 144(1), 34-44 (2015)

    124. K. M. Akat, Y. A. Lee, A. Hurley, P. Morozov, K. E. Max, M. Brown, K. Bogardus, A. Sopeyin, K. Hildner, T. G. Diacovo, M. F. Neurath, M. Borggrefe and T. Tuschl: Detection of circulating extracellular mRNAs by modified small-RNA-sequencing analysis. JCI Insight, 5 (2019)

    125. M. Arenas-Padilla and V. Mata-Haro: Regulation of TLR signaling pathways by microRNAs: implications in inflammatory diseases. Cent Eur J Immunol, 43(4), 482-489 (2018)

    126. H. Rupani, R. T. Martinez-Nunez, P. Dennison, L. C. Lau, N. Jayasekera, T. Havelock, A. S. Francisco-Garcia, C. Grainge, P. H. Howarth and T. Sanchez-Elsner: Toll-like Receptor 7 Is Reduced in Severe Asthma and Linked to an Altered MicroRNA Profile. Am J Respir Crit Care Med, 194(1), 26-37 (2016)

    127. Z. Huang, J. Gan, Z. Long, G. Guo, X. Shi, C. Wang, Y. Zang, Z. Ding, J. Chen, J. Zhang and L. Dong: Targeted delivery of let-7b to reprogramme tumor-associated macrophages and tumor infiltrating dendritic cells for tumor rejection. Biomaterials, 90, 72-84 (2016)

    128. W. A. He, F. Calore, P. Londhe, A. Canella, D. C. Guttridge and C. M. Croce: Microvesicles containing miRNAs promote muscle cell death in cancer cachexia via TLR7. Proc Natl Acad Sci U S A, 111(12), 4525-9 (2014)

    129. P. Ranganathan, A. Ngankeu, N. C. Zitzer, P. Leoncini, X. Yu, L. Casadei, K. Challagundla, D. K. Reichenbach, S. Garman, A. S. Ruppert, S. Volinia, J. Hofstetter, Y. A. Efebera, S. M. Devine, B. R. Blazar, M. Fabbri and R. Garzon: Serum miR-29a Is Upregulated in Acute Graft-versus-Host Disease and Activates Dendritic Cells through TLR Binding. J Immunol, 198(6), 2500-2512 (2017)

    130. N. Hoshikawa, A. Sakai, S. Takai and H. Suzuki: Targeting Extracellular miR-21-TLR7 Signaling Provides Long-Lasting Analgesia in Osteoarthritis. Mol Ther Nucleic Acids, 19, 199-207 (2020)

    131. C. K. Park, Z. Z. Xu, T. Berta, Q. Han, G. Chen, X. J. Liu and R. R. Ji: Extracellular microRNAs activate nociceptor neurons to elicit pain via TLR7 and TRPA1. Neuron, 82(1), 47-54 (2014)

    132. F. Heil, H. Hemmi, H. Hochrein, F. Ampenberger, C. Kirschning, S. Akira, G. Lipford, H. Wagner and S. Bauer: Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8. Science, 303(5663), 1526-9 (2004)

    133. V. Hornung, M. Guenthner-Biller, C. Bourquin, A. Ablasser, M. Schlee, S. Uematsu, A. Noronha, M. Manoharan, S. Akira, A. de Fougerolles, S. Endres and G. Hartmann: Sequence-specific potent induction of IFN-alpha by short interfering RNA in plasmacytoid dendritic cells through TLR7. Nat Med, 11(3), 263-70 (2005)

    134. M. Sioud: Induction of inflammatory cytokines and interferon responses by double-stranded and single-stranded siRNAs is sequence-dependent and requires endosomal localization. J Mol Biol, 348(5), 1079-90 (2005)

    135. A. Forsbach, J. G. Nemorin, C. Montino, C. Muller, U. Samulowitz, A. P. Vicari, M. Jurk, G. K. Mutwiri, A. M. Krieg, G. B. Lipford and J. Vollmer: Identification of RNA sequence motifs stimulating sequence-specific TLR8-dependent immune responses. J Immunol, 180(6), 3729-38 (2008)

    136. S. S. Diebold, C. Massacrier, S. Akira, C. Paturel, Y. Morel and C. Reis e Sousa: Nucleic acid agonists for Toll-like receptor 7 are defined by the presence of uridine ribonucleotides. Eur J Immunol, 36(12), 3256-67 (2006)

    137. A. D. Judge, V. Sood, J. R. Shaw, D. Fang, K. McClintock and I. MacLachlan: Sequence-dependent stimulation of the mammalian innate immune response by synthetic siRNA. Nat Biotechnol, 23(4), 457-62 (2005)

    138. H. Peacock, R. V. Fucini, P. Jayalath, J. M. Ibarra-Soza, H. J. Haringsma, W. M. Flanagan, A. Willingham and P. A. Beal: Nucleobase and ribose modifications control immunostimulation by a microRNA-122-mimetic RNA. J Am Chem Soc, 133(24), 9200-3 (2011)

    139. M. de Marcken, K. Dhaliwal, A. C. Danielsen, A. S. Gautron and M. Dominguez-Villar: TLR7 and TLR8 activate distinct pathways in monocytes during RNA virus infection. Sci Signal, 12(605) (2019)

    140. D. E. Giza, E. Fuentes-Mattei, M. D. Bullock, S. Tudor, M. J. Goblirsch, M. Fabbri, F. Lupu, S. J. Yeung, C. Vasilescu and G. A. Calin: Cellular and viral microRNAs in sepsis: mechanisms of action and clinical applications. Cell Death Differ, 23(12), 1906-1918 (2016)

    141. S. Tudor, D. E. Giza, H. Y. Lin, L. Fabris, K. Yoshiaki, L. D'Abundo, K. M. Toale, M. Shimizu, M. Ferracin, K. B. Challagundla, M. A. Cortez, E. Fuentes-Mattei, D. Tulbure, C. Gonzalez, J. Henderson, M. Row, T. W. Rice, C. Ivan, M. Negrini, M. Fabbri, J. S. Morris, S. C. Yeung, C. Vasilescu and G. A. Calin: Cellular and Kaposi's sarcoma-associated herpes virus microRNAs in sepsis and surgical trauma. Cell Death Dis, 5, e1559 (2014)

    142. L. S. Young and A. B. Rickinson: Epstein-Barr virus: 40 years on. Nat Rev Cancer, 4(10), 757-68 (2004)

    143. A. Ferrajoli, C. Ivan, M. Ciccone, M. Shimizu, Y. Kita, M. Ohtsuka, L. D'Abundo, J. Qiang, S. Lerner, N. Nouraee, K. G. Rabe, L. Z. Rassenti, K. Van Roosbroeck, J. T. Manning, Y. Yuan, X. Zhang, T. D. Shanafelt, W. G. Wierda, S. Sabbioni, J. J. Tarrand, Z. Estrov, M. Radovich, H. Liang, M. Negrini, T. J. Kipps, N. E. Kay, M. Keating and G. A. Calin: Epstein-Barr Virus MicroRNAs are Expressed in Patients with Chronic Lymphocytic Leukemia and Correlate with Overall Survival. EBioMedicine, 2(6), 572-82 (2015)

    144. K. Van Roosbroeck and G. A. Calin: When kissing (disease) counts. Blood, 127(16), 1947-8 (2016)

    145. T. J. Cremer, D. H. Ravneberg, C. D. Clay, M. G. Piper-Hunter, C. B. Marsh, T. S. Elton, J. S. Gunn, A. Amer, T. D. Kanneganti, L. S. Schlesinger, J. P. Butchar and S. Tridandapani: MiR-155 induction by F. novicida but not the virulent F. tularensis results in SHIP down-regulation and enhanced pro-inflammatory cytokine response. PLoS One, 4(12), e8508 (2009)

    146. R. O. Eren, M. Reverte, M. Rossi, M. A. Hartley, P. Castiglioni, F. Prevel, R. Martin, C. Desponds, L. F. Lye, S. K. Drexler, W. Reith, S. M. Beverley, C. Ronet and N. Fasel: Mammalian Innate Immune Response to a Leishmania-Resident RNA Virus Increases Macrophage Survival to Promote Parasite Persistence. Cell Host Microbe, 20(3), 318-328 (2016)

    147. C. E. McCoy, F. J. Sheedy, J. E. Qualls, S. L. Doyle, S. R. Quinn, P. J. Murray and L. A. O'Neill: IL-10 inhibits miR-155 induction by toll-like receptors. J Biol Chem, 285(27), 20492-8 (2010)

    148. H. Zhou, X. Huang, H. Cui, X. Luo, Y. Tang, S. Chen, L. Wu and N. Shen: miR-155 and its star-form partner miR-155* cooperatively regulate type I interferon production by human plasmacytoid dendritic cells. Blood, 116(26), 5885-94 (2010)

    149. M. Jiang, R. Broering, M. Trippler, J. Wu, E. Zhang, X. Zhang, G. Gerken, M. Lu and J. F. Schlaak: MicroRNA-155 controls Toll-like receptor 3- and hepatitis C virus-induced immune responses in the liver. J Viral Hepat, 21(2), 99-110 (2014)

    150. S. R. Quinn, N. E. Mangan, B. E. Caffrey, M. P. Gantier, B. R. Williams, P. J. Hertzog, C. E. McCoy and L. A. O'Neill: The role of Ets2 transcription factor in the induction of microRNA-155 (miR-155) by lipopolysaccharide and its targeting by interleukin-10. J Biol Chem, 289(7), 4316-25 (2014)

    151. R. M. O'Connell, K. D. Taganov, M. P. Boldin, G. Cheng and D. Baltimore: MicroRNA-155 is induced during the macrophage inflammatory response. Proc Natl Acad Sci U S A, 104(5), 1604-9 (2007)

    152. K. Migita, N. Iwanaga, Y. Izumi, C. Kawahara, K. Kumagai, T. Nakamura, T. Koga and A. Kawakami: TNF-alpha-induced miR-155 regulates IL-6 signaling in rheumatoid synovial fibroblasts. BMC Res Notes, 10(1), 403 (2017)

    153. D. Yee, K. M. Shah, M. C. Coles, T. V. Sharp and D. Lagos: MicroRNA-155 induction via TNF-alpha and IFN-gamma suppresses expression of programmed death ligand-1 (PD-L1) in human primary cells. J Biol Chem, 292(50), 20683-20693 (2017)

    154. H. Li, X. Zhang, L. Gao, J. Min, Y. Zhang, R. Zhang and Y. Yang: TNF-alpha is upregulated in subacute thyroiditis and stimulates expression of miR-155-5p in thyroid follicle cells. Discov Med, 26(142), 67-77 (2018)

    155. T. Wu, M. Xie, X. Wang, X. Jiang, J. Li and H. Huang: miR-155 modulates TNF-alpha-inhibited osteogenic differentiation by targeting SOCS1 expression. Bone, 51(3), 498-505 (2012)

    156. Y. Sun, J. Cai, F. Ma, P. Lu, H. Huang and J. Zhou: miR-155 mediates suppressive effect of progesterone on TLR3, TLR4-triggered immune response. Immunol Lett, 146(1-2), 25-30 (2012)

    157. R. Rao, S. A. Rieder, P. Nagarkatti and M. Nagarkatti: Staphylococcal enterotoxin B-induced microRNA-155 targets SOCS1 to promote acute inflammatory lung injury. Infect Immun, 82(7), 2971-9 (2014)

    158. N. J. Galbraith, J. Burton, M. B. Ekman, J. Kenney, S. P. Walker, S. Manek, C. Bishop, J. V. Carter, S. A. Gardner and H. C. Polk: IkappaK-16 decreases miRNA-155 expression and attenuates the human monocyte inflammatory response. PLoS One, 12(9), e0183987 (2017)

    159. A. T. Billeter, J. Hellmann, H. Roberts, D. Druen, S. A. Gardner, H. Sarojini, S. Galandiuk, S. Chien, A. Bhatnagar, M. Spite and H. C. Polk, Jr.: MicroRNA-155 potentiates the inflammatory response in hypothermia by suppressing IL-10 production. FASEB J, 28(12), 5322-36 (2014)

    160. Y. Wen, X. Zhang, L. Dong, J. Zhao, C. Zhang and C. Zhu: Acetylbritannilactone Modulates MicroRNA-155-Mediated Inflammatory Response in Ischemic Cerebral Tissues. Mol Med, 21, 197-209 (2015)

    161. G. Swaminathan, F. Rossi, L. J. Sierra, A. Gupta, S. Navas-Martin and J. Martin-Garcia: A role for microRNA-155 modulation in the anti-HIV-1 effects of Toll-like receptor 3 stimulation in macrophages. PLoS Pathog, 8(9), e1002937 (2012)

    162. Z. Wen, L. Xu, X. Chen, W. Xu, Z. Yin, X. Gao and S. Xiong: Autoantibody induction by DNA-containing immune complexes requires HMGB1 with the TLR2/microRNA-155 pathway. J Immunol, 190(11), 5411-22 (2013)

    163. K. Wang and P. F. Li: Foxo3a regulates apoptosis by negatively targeting miR-21. J Biol Chem, 285(22), 16958-66 (2010)

    164. B. Gan, C. Lim, G. Chu, S. Hua, Z. Ding, M. Collins, J. Hu, S. Jiang, E. Fletcher-Sananikone, L. Zhuang, M. Chang, H. Zheng, Y. A. Wang, D. J. Kwiatkowski, W. G. Kaelin, Jr., S. Signoretti and R. A. DePinho: FoxOs enforce a progression checkpoint to constrain mTORC1-activated renal tumorigenesis. Cancer Cell, 18(5), 472-84 (2010)

    165. T. La, G. Z. Liu, M. Farrelly, N. Cole, Y. C. Feng, Y. Y. Zhang, S. K. Sherwin, H. Yari, H. Tabatabaee, X. G. Yan, S. T. Guo, T. Liu, R. F. Thorne, L. Jin and X. D. Zhang: A p53-Responsive miRNA Network Promotes Cancer Cell Quiescence. Cancer Res, 78(23), 6666-6679 (2018)

    166. R. Echavarria, D. Mayaki, J. C. Neel, S. Harel, V. Sanchez and S. N. Hussain: Angiopoietin-1 inhibits toll-like receptor 4 signalling in cultured endothelial cells: role of miR-146b-5p. Cardiovasc Res, 106(3), 465-77 (2015)

Share and Cite
Saswati Banerjee, Winston E. Thompson, Indrajit Chowdhury. Emerging roles of microRNAs in the regulation of Toll-like receptor (TLR)-signaling. Frontiers in Bioscience-Landmark. 2021. 26(4); 771-796.