Navigation
Open Access
Article

GMP-grade platelet lysate enhances proliferation and migration of tenon fibroblasts

Augusto Carducci1,Gaia Scafetta1,Camilla Siciliano1,2,Roberto Carnevale3,Paolo Rosa1,Andrea Coccia1,Giorgio Mangino1,Antonella Bordin1,Enzo Maria Vingolo1,4,Luca Pierelli5,6,Eugenio Lendaro1,Giuseppe Ragona1,Giacomo Frati1,7,Elena De Falco1,*
1
Department of Medical-Surgical Science and Biotechnologies, Faculty of Pharmacy and Medicine, University of Rome, Sapienza, C.so della Repubblica 79, 04100 Latina, Italy
2
Center for Life Nano Science, Sapienza, Istituto Italiano di Tecnologia, Rome, Italy
3
Department of Internal Medicine and Medical Specialties, University of Rome, Sapienza, Rome, Italy
4
Department of Ophthalmology, Sapienza University of Rome, Polo Pontino, A. Fiorini Hospital, Via Firenze, 04019 Terracina
5
Immunohematology and Transfusion Medicine, San Camillo Forlanini Hospital, Rome, Italy
6
Department of Experimental Medicine, University of Rome, Sapienza, Rome, Italy
7
IRCCS Neuromed, Località Camerelle, 86077 Pozzilli, Italy
DOI: 10.2741/E753 Volume 8 Issue 1, pp.84-99
Published: 01 January 2016
*Corresponding Author(s):  
Elena De Falco
E-mail:  
elena.defalco@uniroma1.it
Abstract

Tenon’s fibroblasts (TFs), widely employed as in vitro model for many ophthalmological studies, are routinely cultured with FBS. Platelet Lysate (PL), a hemoderivate enriched with growth factors and cytokines has been largely tested in several clinical applications and as substitute of FBS in culture. Here, we investigate whether PL can exert biological effects on TF populations similarly to other cell types. Results show that PL significantly enhances cell proliferation and migration vs. FBS, without influencing cell size/granularity. Upregulation of EGF, VEGF, KDR, MMP2-9, FAK mRNA levels also occurs and phosphorylation of AKT but not of ERK1/2 is significantly enhanced. The inhibition of the PI3kinase/AKT pathway with the specific inhibitor wortmannin, decreases PL-induced cell migration but not proliferation. Condition supernatants containing PL show increased bioavailability of Nitric Oxide and reduced levels of 8-Iso-PGF2-alpha, correlating with cell proliferation and migration. Pro-angiogenic/inflammatory soluble factors (GRO, Angiogenin, EGF, I-309, PARC) are exclusively or greater expressed in media containing PL than FBS. GMP-grade PL preparations positively influence in vitro biological effects of TFs representing a suitable and safer alternative to FBS.

Key words

Tenon Fibroblasts, Platelet Lysate, GMP-grade, Growth Factors, Cytokines, AKT, ERK1/2, Oxidative Stress

2. Introduction

Tenon’s capsule mainly functions as a cavity containing the ocular bulb, which is thus supported during eye movements (1). Fibroblasts derived from Tenon’s capsule represent the main stromal fraction. Currently, they are a versatile experimental in vitro model for several ophthalmological studies, ranging from in vitro drug testing to novel toxicological screenings, to wound healing repair and to inflammatory and pathological process (2-5). Besides, human TFs have been demonstrated to sustain the in vitro expansion of limbal stem cells (6) and even to be reprogrammed to generate induced pluripotent stem cells (7), thus paving the way to replace human feeder layers such as dermal fibroblasts with those derived from specific ocular tissues.

For all the aforementioned reasons, TFs are such a widely accepted and suitable model that the in vitro expansion is an unavoidable step. Normally, the in vitro culturing of human TFs requires the use of foetal bovine (FBS) or autologous serum derived from patients when available. Although bovine serum is enriched in growth factors, hormones and small peptides beneficial to stimulate cell proliferation (8), recently certain soluble factors released by activated platelets have been now demonstrated to ameliorate cell growth than FBS and plasma (8-10). Furthermore, from a clinical-translational standpoint, the culturing of any cell product with FBS including TFs still represents a threat due to potential risk of zoonosis.

Accordingly, Platelet lysate (PL), a hemocomponent enriched with growth factors and cytokines (11) has been currently employed for several treatments including skin ulcers, orthopaedic and ophthalmological conditions (12-17). For instance, a number of clinical studies have indicated that the topical administration of PL can represent an effective procedure to manage both skin and corneal ulcers due to the numerous growth factors and cytokines released by platelets which can be collected during the manufacturing process (18).

Among all soluble factors present in PL preparations, PDGF, TGF-alpha, VEGF, TGF-beta1 and EGF undoubtedly play a key role in stimulating and improving proliferation and angiogenic processes, as well as fibroblast migration and collagen production (19-21). In addition, these growth factors are able to chemotactically recruit monocytes, macrophages and lymphocytes to the site of injury, improving both tissue regeneration and growth of fibroblast-like cells (20-22).

Interestingly, PL has also been successfully applied for the expansion of human mesenchymal stem cells (11), endothelial (23) and stromal cells including dermal fibroblasts (24), acting as an effective replacement of FBS or human serum in culture.

Although PL is widely employed, its biological significance has still to be elucidated. A proper investigation about the efficacy of PL on a non-dermal origin fibroblastoid population could allow to develop a novel in vitro culture model to study the biology of human TFs and the effects of platelet-derived products, which have yet to be defined. In other words, the in vitro model reproduced by ocular fibroblasts would also represents the reasonable first step in studying the effects of new blood-derived preparations such as PL.

Recently, we have standardized a technique to isolate and expand human TFs (4) and also shown the efficacy of our patented GMP-grade PL (Pub. No. WO/2013/042095) to sustain cell proliferation and mesodermal transdifferentiation of human adipose tissue derived Mesenchymal stem cells (11).

Here we have investigated whether our patented GMP-grade PL (11) was equally effective on human TF growth and differentiation properties. We firstly explore both biological properties and potential molecular mechanisms of PL on non-dermal tissue specific populations such as human TFs.

We report that PL enhances cell proliferation and migration, in correlation with a significant reduction in oxidative stress levels. Moreover, phosphorylation of AKT but not of ERK1/2 is enhanced in presence of PL compared to FBS. The increase in cell migration but not proliferation can be attenuated by wortmannin, a selective inhibitor of PI3 kinase/AKT pathway. Finally, the cytokine profile shows that a set of soluble factors with pro-inflammatory/angiogenic/proliferative activity (GRO, Angiogenin, EGF, I-309, PARC) are exclusively present in PL preparations compared to FBS.

3. Materials and Methods

3.1. Human TF cultures

Human primary TF cultures were obtained as we previously described (4,6). Briefly, explants were mechanically minced and cultured with complete medium (DMEM High glucose/1%PenStep/1%Glutammine/1%Non-essential aminoacids/10% FBS or PL). After reaching semi-confluence, fibroblasts were trypsinized (0.0.5%Trypsin/0.0.2%EDTA, Cat. N. X0930-100) and expanded with complete medium. Written informed consents were obtained from patients before surgery. The protocol was conducted in compliance with the Tenets of the Declaration of Helsinki for experiments involving human tissues. All data were de-identified and analysed anonymously. All reagents for complete media but PL were purchased from Biowest, Nuaillé, France. Experiments were performed at passages 3 (early passage) and/or 6 (late passage).

3.2. GMP-grade platelet lysate (pl) preparation

GMP-grade PL (Pub. No. WO/2013/042095) was prepared and virally inactivated according to the protocol that we previously described (11). Briefly, after obtaining informed consent, buffy coats from healthy volunteers were centrifuged and treated with InterSol solution (318 mgNa-citrate 2H2O, 305 mg Na 2-phosphate anhydro, 105 mg Na dihydrogen phosphate 2H2O, 442 mg Na-Acetate 3H2O, 452 mg NaCl, 100 ml H2O, Fenwal Inc. Lake Zurich, Illinois) and subsequently with 20-30% human plasma. Potential pathogens were inactivated by using the Intercept™ Blood System for Platelets (Cerus Corporation, Concord, California USA). Platelet preparation was then collected in a final single bag and stored at -80°C for 24 h before thawing at 37°C for 60 min. This procedure was repeated three times to enrich the pool of growth factors. Concentration and sterility of the preparation was determined by the haematology analyzer ABX Pentra DX 120 (Horiba ABX, Montpellier, France) and BacT/ALERT System (bioMérieux SA, Marcy l’Etoile, France), respectively. Before adding PL in culture, 5U/ml heparin were added to avoid fibrin gel formation.

3.3. Flow cytometry analysis

Human TFs (80-90% confluence) were detached by 0.0.5%Trypsin/0.0.2%EDTA, then washed with PBS/2% FBS and resuspended in PBS/FACS Flow as reported elsewhere (4,6,25). Afterwards 1×105 cells for each treatment (1, 5 and 10% PL and FBS) were stained with Propidium iodide (10 ng/ml, Sigma) in order to discriminate live/dead cells (25). Samples were acquired by cytofluorimetry (FACSAria II and DiVa Software v6.1.1., B&D, San Jose, USA) and analysed by Flowing Software (v2.5.1., Turku Centre for Biotechnology, Turku, Finland) by evaluating the light scattering properties (forward and side scatter) only on live cells. Identical instrument settings were used for human TFs of each patient cultured in PL or FBS.

3.4. Cell growth

Cell proliferation was evaluated by MTS assay (4,26-27) (CellTiter 96 AQueus One Solution Cell Proliferation Assay, Promega, Milan, Italy) using a colorimetric method according to manufacturer’s instructions and seeding 1000 cells/well into 96 well-plates in quintuplicate conditioned for 0, 3 and 7 days with PL or FBS. The optical density signal (492 nm) was normalized to that of day 0 after cell seeding.

3.5. Real Time PCR

RNA was extracted using RNeasy MicroKit (Quiagen, Hilden, Germania). C-DNA synthesis was performed from 1 μg RNA by using High Capacity cDNA Reverse Transcription Kit. Total RNA was extracted (Total RNA Purification Kit, Cat. N. 00375, Norgen Bioteck Corp, Thorold, Canada) and reverse-transcribed into complementary DNA (cDNA) using Tetro cDNA Synthesis kit (4,26-27) (Cat. No BIO65043 Bioline, Aurogene, Italy). Transcript levels were assessed by quantitative PCR using Sensimix Sybr Green (Cat. N.QT605-05 SensiMixTM Sybr Kit Bioline, Aurogene, Italy) in a 7900HT Fast (Applied Biosystem, Life Technology, Italy) for a set of gene markers listed in Table 1. qPCR conditions were set as following: 15s at 95°C, followed by 40 cycles of 95° for 15s and 60°C for 1 minute. 18S was used as housekeeping gene.

Table 1. Primers used in RT-PCR
TargetForwardReverse
EGFGGATAGCCAACAAACACACTGGCACGTGCAGTAATAGGAT
FGFCCTGGGGAGAAAGCTATGCTTCACGGGTAACAG
VEGFAGCTGCGCTGATAGACATCCCTACCTCCACCATGCCAAGT
KDRTGCCTACCTCACCTGTTTCCCGGCTCTTTCGCTTACTGTT
MMP2GGAAAGCCAGGATCCATTTTATGCCGCCTTTAACTGGAG
MMP9TTGGTCCACCTGGTTCAACTACGACGTCTTCCAGTACCGA
FAKCCTGGTCCACTTGATCAGCTAGCCAAAAGGATTTCTAAACCAG
alpha-SMACCAGAGCCATTGTCACACACCAGCCAAGCACTGTCAGG
18SCAATTATTCCCCATGAACGGGGACTTAATCAACGCAAGC

3.6. Inhibition of the PI3 Kinase/AKT pathway

Human TFs were starved for 3 hours in complete medium supplemented with 0.2.% FBS or PL, then trypsinized and seeded for the MTS and migration assays. For cell proliferation and migration tests, wortmannin (Cat. N. 9951, Cell Signaling Technology, Danvers, USA) was added at a concentration of 500nM and 2.5 μM, respectively.

3.7. Migration Assay

Semi confluent human TFs were resuspended in serum free medium, seeded at 5×104/well in the upper side of 24 well Boyden chamber (8 µm pores, BD Biosciences) and incubated at 37°C for 16 hours. The lower chamber contained DMEM with 10% PL or FBS. Afterwards, the inner side of the insert was wiped with a wet swab, in order to remove the cells and the outer side of the insert gently rinsed with PBS and stained with 0.2.5% Giemsa (Sigma, St. Louis, USA) for 15 min, rinsed again, and then allowed to dry (11,27-28). Migrated cells were counted (ten fields per chamber) under a light microscope. Experiments were repeated three times in duplicate. In order to exclude any potential interference of wortmannin with cell adhesion, we have also seeded in 96 well plates coated with fibronectin (Becton–Dickinson, Bedford, MA) human TFs (1×105/well) in culture medium containing FBS or PL with wortmannin. Cells cultured with FBS or PL alone were used as control. After 6 hours of incubation, cells were washed twice with PBS to remove non-adherent cells. The attached cells were analyzed by MTT assay. Data are presented as means ±SD.

3.8. Human TF 8-iso-PGF2-alpha assay and nitric oxide bioavailability

Isoprostanes formation were measured in cell suspension of human TFs treated with PL (%) or FBS (%). The supernatant was stored at -80°C until measurement. Quantification of isoprostanes was performed measuring 8-iso-PGF2-alpha by EIA assay method (Tema Ricerca, Milan, Italy). Intra-assay and inter-assay coefficients of variation were 5.8.% and 5.0.% respectively. A colorimetric assay kit (Tema Ricerca, Milan, Italy) was used to determine the nitric oxide bioavailability, evaluated by metabolites nitrite and nitrate (NOx) in 100 μl of human TF conditioned supernatants maintained under stirring condition 10 min at 37°C. Intra-assay and inter-assay coefficients of variation were 2.9.% and 1.7.%, respectively.

3.9. Western Blot

After a 24 hours of starvation in complete medium containing 0.2.% FBS or PL and stimulation with 10% FBS or PL for 1, 5, 10 minutes, human TFs were washed and lysed for 30 min at +4°C in equal volumes of ice-cold RIPA lysis buffer (10 mM Tris pH 8, 1%Triton, 0,1% SDS, 0,1% Deoxycholate, 140 mM NaCl, 1 mM EDTA) and a cocktail of protease inhibitors (1 mM DTT, 1 mM PMSF, 1 Protease inhibitor tablet/10 mL Sigma, St. Louis, USA). Homogenates were clarified by centrifugation. Supernatants were boiled for 5 min in Laemmli sample buffer. Equivalent protein quantities, as determined by Bradford, were loaded on each gel. Proteins were separated by SDS-PAGE electrophoresis and electrotransferred to polyvinylidene difluoride membranes and incubated with the primary antibody against human phospho-AKT, AKT, phospho-ERK1/2 and ERK (All Cell Signaling Technology, Danvers, USA Cat. N. 9271S, Cat. N. 9272S, Cat. N. 9106S and Cat. N. 4695S, respectively) and a horseradish peroxidase-conjugated mouse or rabbit secondary antibody (1:10000, GE Healthcare Bio-Science, Piscataway, NJ, USA). The membranes were developed by enhanced chemiluminescence kit (ECL, GE Healthcare Bio-Science, Piscataway, NJ, USA).

3.10. Cytokine profile assay

The simultaneous detection of 80 multiple cytokines/growth factors in media containing PL (DMEM/10%PL) was performed by using the human Cytokine Antibody Array C5 (Ray Biotech, Inc.) according to the manufacturer’s instructions. An equal volume of media and protein has been loaded on the arrays. Samples have been normalized on positive controls (Array). Media containing FBS (10%) has been used as reference.

3.11. Statistical analysis

Statistical analysis was performed using the statistical software GraphPad Prism 5 software (San Diego, USA). The independent sample two-tailed t-test with associated 95% confidence intervals was used to compare the single data. For multiple comparisons, the One or Two-way analysis of variance (ANOVA) test and Bonferroni post-hoc test were used. Data are expressed as mean±SD unless specified. Ap<0.0.5 was considered statistically significant. For oxidative stress experiments, normal distribution of parameters was assessed by Kolmogorov–Smirnov test. Student unpaired t test and Pearson product-moment correlation analysis were used for normally distributed continuous variables. Appropriate nonparametric tests (Mann-Whitney U test and Spearman rank correlation test) were employed for all the other variables.

4. Results

4.1. Cell size and proliferation

In order to assess the effects of PL on cell cultures, we isolated human TFs, by halfing the original biopsy and either treating with PL (10%) or FBS (10%, control). In order to minimize the interpatient variability experiments were performed on the same set of patients. As shown in Figure 1, human TFs cultured with the standard in vitro concentration of PL (10%) (11,29) displayed a more enhanced spindle-shape morphology compared to FBS (10%), when observed under inverted-phase microscope. In order to verify this, serum (PL)-starved TF cultures were stimulated with scalar concentrations (1,5,10%) of PL, FBS or DMEM alone (negative control). Three different batches of FBS and PL (lot. 8,9,20) have been tested. Cell size was analysed by flow cytometry with regard to physical characteristics such as surface area and cell granularity. Results have shown that after treatment with different concentrations of PL, neither the measurement of the forward (which is proportional to cell-surface area or size) nor of the side scatter (which reflects the cell granularity and complexity) show statistically significant differences compared with FBS (p>0.0.5 at all concentrations, Figure 2A-B). Propidium Iodide staining, used to discriminate live/dead cells within the TF population has shown no statistically significant difference between all samples, indicating high viability in all cultures (Figure 12).

Figure 1. Images from optical microscope. Human TFs at passage 3 showing a more enhanced spindle-shape morphology, when cells are cultured in PL (10%) compared to FBS (10%). PL, platelet lysate.

Figure 2. A-B. Flow Cytometry Analysis. (A) Graphs of the Forward and Side scatter Analysis of human TFs at passage 3 displaying that in a concentration range of 1, 5 and 10%, PL is not able to significantly influence physical cell properties such as cell dimension and granularity (p>0.0.5) relative to FBS. (B) Representative cytofluorimetric dot plots showing the Side and the Forward scatter at different concentrations (1, 5, 10%) of FBS and PL used. PL, platelet lysate; SSC, Side scatter; FSC, Forward scatter; H, height; A, Area.

Next, we asked whether PL could influence cell proliferation. By MTS assay we show that after 3 and 7 days of culture with PL (10% at day 3 and 1, 5, 10% at day 7), human TF cell proliferation is statistically significantly increased compared with FBS and DMEM alone (our negative control) (Figure 3, 1 and 5% day 7 p<0.0.01 vs FBS and DMEM; 10% day 3 p<0.0.1 vs DMEM and FBS; 10% day 7 p<0.0.1 and p<0.0.01 vs DMEM and FBS, respectively). A significant increase in cell proliferation can be also observed after 7 days when TFs are cultured with FBS (5 and 10%) compared to DMEM alone (p<0.0.5 day 3 and p<0.0.1 day 7) as expected.

Figure 3. Cell growth. MTS proliferation assay (0, 3, 7 days) showing human TFs at passage 3 cultured with increasing concentration of PL or FBS (1, 5, 10%). PL is able to increase hTF cell proliferation at all concentrations after 7 days of culture compared to FBS. *p<0.0.5, **p<0.0.1. PL, platelet lysate; O.D., optical densities.

4.2. Phenotype analysis and migration assay

We then aimed to assess whether the standard in vitro concentration of PL (10%) could induce in human Tenon’s fibroblasts any variation in the specific mRNA levels of genes known to be involved in basic biological process including wound healing and/or repair/angiogenesis (26,30-32). The genes investigated were: epidermal growth factor (EGF), fibroblast growth factor (FGF) and the vascular endothelial growth factor (VEGF)/kinase insert domain receptor (KDR) axis. We also investigated whether PL could affect cell adhesion, motility and myofibroblast transdifferentiation of human TFs by modulating the transcriptional levels of the metalloproteinase (MMP) 2 and 9, the Focal Adhesion Kinase (FAK) and the alpha smooth muscle actin (alpha-SMA) genes, all of them active in the aforementioned stromal processes (32-34). We observed (Figure 4) a statistically significant upregulation of EGF, VEGF, KDR, MMP2, MMP9 and FAK mRNA levels at both early (passage 3, p=0.0.026, p<0.0.001, p<0.0.001, p=0.0.22, p=0.0.078, p=0.0.057) and later passages (passage 6, p=0.0.004, p=0.0.001, p<0.0.001, p=0.0.004, p=0.0.009, p=0.0.11) of human TFs cultured in media supplemented with PL compared to FBS. FGF mRNA levels increased in presence of PL only at later passage (p<0.0.001).

Whereas, alpha-SMA mRNA levels were upregulated at both passage 3 and 6 of human TFs (p=0.0.007 and p=0.0.38, respectively) only when cultured with FBS compared to PL, which are maintained stable. Afterwards, in order to explore the influence of PL on the migratory activity of human TFs, cells were subjected to Transwell migration assay. Results show that PL significantly increased cell migration compared with FBS (p=0.0.1, Figure 5A-B).

Figure 4. RTPCR Analysis. Phenotypical modifications of human TFs after treatment with PL or FBS (10%) evaluated by RT-PCR. A significant upregulation of EGF, VEGF, KDR, MMP2, MMP9 and FAK mRNA levels is observed when human TFs are cultured with PL vs. FBS at both early (P3) and later (P6) passages. FGF mRNA levels are enhanced only in presence of PL and at later passage relative to FBS. Conversely, αSMA mRNA levels are upregulated at the same passages only in presence of FBS but not of PL, where they are maintained unchanged. 18S has been used as housekeeping gene. PL, platelet lysate; P3, passage 3; P6 passage 6. *p<0.0.5, **p<0.0.1, #p<0.0.001.

Figure 5. A-B. Cell migration. (A) Graph showing the ability of PL (10%) to statistically increase cell migration at passage 3 compared to FBS. Migration index expressed in percentage (%) and normalized on FBS has been calculated as the following ratio: number of cells migrated/number of cells plated. *p<0.0.5. (B) Representative microscopic fields of the migration assay after Giemsa staining, highlighting a distinct increased number of human TFs migrated at the bottom of the well in presence of platelet lysate. PL, platelet lysate.

4.3. Intracellular pathway activation

In order to evaluate if intracellular signalling nodes along the MAPK pathway were activated in presence of PL, human TFs were stimulated for 1, 5 and 10 minutes and the protein levels of phosphorylated-AKT and ERK1/2 (23,35) detected by Western Blot. Cells stimulated with PL showed a striking increase in AKT phosphorylation after 1, 5 and 10 minutes of stimulation (Figure 6A-B, p<0.0.5, p<0.0.01 and p<0.0.01, respectively) compared to FBS. This last also had some effect on AKT phosphorylation by enhancing the expression over time (p<0.0.5 and p<0.0.1 at 5 and 10 minutes vs. starved samples, respectively). Both PL and FBS were equally effective to enhance phosphorylation of ERK1/2 with maximum effect after 5 minutes of stimulation (p<0.0.5 PL and p<0.0.1 FBS vs. starved samples, Figure 6C-D).

Figure 6.A-D. Analysis of the signalling pathways. (A) The graph shows that the stimulation with PL (10%; 1, 5 and 10 minutes) is significantly able to enhance the AKT phosphorylation over time compared to FBS (10%). (B) Both PL and FBS treatment induce a significant and equal increase in phosphorylation of ERK1/2 vs. starved samples. (C) Representative images of the Western Blot assay displaying phospho-AKT and AKT total and (D) phospho-ERK1/2 and ERK total at the time course of stimulation with PL and FBS. The phospho-AKT/AKT and phospho ERK1/2-ERK1/2 ratio have been normalized on the starved samples. PL, platelet lysate. *p<0.0.5, **p<0.0.1, #p<0.0.01

Afterwards, in order to clarify the role of the AKT pathway in mediating the effects of PL on human TFs, we examined cell proliferation and migration after treatment with wortmannin, a specific inhibitor of the PI3 kinase/AKT pathway. We show that wortmannin had no effect on human TF proliferation rate in presence of FBS or PL (Figure 7, p>0.0.5), without exerting cytotoxic effect at the concentration used, whereas cell migration was significantly decreased in presence of both agents (p=0.0.043 and p=0.0.42 FBS and PL, Figure 8). A potential interference of wortmannin with human TF adhesion has been ruled out by MTT assay, showing the inability of the specific inhibitor to affect TF adhesion onto a fibronectin substrate either in presence of FBS or PL (Figure 13).

Figure 7. Effect of the inhibition of the PI3K/AKT pathway on cell proliferation. MTS assay (0, 3, 7 days) of human TFs after treatment with FBS or PL and in presence or absence of wortmannin, showing no influence of the specific inhibitor of the PI3 kinase/AKT pathway on hTF cell proliferation either in presence of PL and FBS. O.D., optical densities; PL, platelet lysate; wt, wortmannin.

Figure 8. Effect of the inhibition of the PI3K/AKT pathway on cell migration. Migration assay of human TFs after treatment FBS or PL in presence of wortmannin, displaying a statistically significant reduction in TF cell migration when cultured with PL or FBS. *p<0.0.5, **p<0.0.1. PL, platelet lysate; wt, wortmannin.

4.4. Oxidative stress analysis

Given the involvement of oxidative stress mediated by platelets on proliferation, differentiation and pro-fibrotic transformation of fibroblasts (36-38) and the ability of both PL and ROS species to exert regenerative effects (39-42), we asked whether PL could influence oxidative stress levels. To this purpose, we analysed the production of 8-iso-prostaglandin-F(2alpha) (8-iso-PGF2-alpha-III), a marker of oxidative stress (43) and that of nitric oxide (NO) in conditioned supernatants of human TFs. We show that conditioned media derived from human TFs cultured in presence of PL exhibited higher levels of NO, according to the production of nitrite/nitrate (p=0.0.02, Figure 9A) and significantly lower level of 8-iso-PGF2-alpha (p=0.0.01, Figure 9B), compared to those obtained in presence of FBS. Moreover, univariate correlation analysis demonstrated that both proliferation and migration were correlated positively with NOx formation (Rs=0.6.89; p<0.0.1, Figure 10A; Rs=0.7.25; p<0.0.01, Figure 10C) and negatively with 8-iso-PGF2-alpha (Rs=-0.4.84; p<0.0.5, Figure 10B; Rs=-0.4.76; p<0.0.5, Figure 10D) of cells treated with PL. No correlation was found with FBS treatment (data not shown).

Figure 9. A-B. Analysis of the oxidative stress levels. (A) Conditioned media derived from human TFs at passage 3 cultured in presence of PL showing a significant higher production of nitrate/nitrite (Nox formation μM) but (B) significant lower levels of isoprostanes (8-iso-PGF2-alpha-III, pmol/L) respect to FBS. PL, platelet lysate.

Figure 10. A-D. Statistical correlations between oxidative stress levels and TF proliferation and migration in presence of PL. (A) The production of nitrite/nitrate (NOx formation) positively correlates (p<0.0.1) with cell proliferation effect induced by the use of PL in human TFs, whereas (B) 8-iso-PGF2alpha III production inversely correlates (p<0.0.5). (C) Cell migration phenomenon displays even a more striking positive correlation with the production of nitrite/nitrate (NOx formation, p<0.0.01) and in presence of PL (10%). (D) Differently, an inverse linear correlation with 8-iso-PGF2-alpha-III production can be found (p<0.0.5). PL, platelet lysate.

4.5. Detection of cytokines and growth factors in PL

Finally, in order to investigate whether soluble factors within PL may contribute to its biological effects, we have screened the medium containing PL (DMEM/10% PL) regarding its content of 80 pro-inflammatory growth factors and cytokines, known to be involved in cell activation/proliferation, chemotaxis, angiogenesis and wound healing. Medium with FBS (DMEM/10% FBS) has been used as comparison. Results show that pro-inflammatory/angiogenic factors such as GRO, Angiogenin, EGF, I-309 and PARC are exclusively expressed in DMEM/10%PL and absent in DMEM/10%FBS, whereas TGF-beta2, Plgf, IL-16, osteopontin, NAP-2, Light, LIF and osteoprotegerin are higher expressed in media supplemented with PL than with FBS (Figure 11A-B).

Figure 11. A-B. Cytokines/Growth factors profile. (A) Representative images of the Cytokine Antibody Arrays showing the multiple expression of 80 pro-inflammatory/angiogenic cytokines/growth factors in DMEM 10% PL and FBS. The coloured circles corresponding to the coloured columns in the graph below. (B) The graph displays how some angiogenic factors (GRO, Angiogenin, EGF, I-309, PARC) are exclusively expressed in PL and absent in FBS. Other soluble factors (TGF-beta2, Plgf, IL-16, osteopontin, NAP-2, Light, LIF, osteoprotegerin) are found greater expressed in PL than in FBS. O.D., optical density. Data are normalized on positive controls of the Arrays (black squares) and on FBS.

Figure 12. Representative cytofluorimetric histograms showing the Propidium Iodide staining at different concentrations (1, 5, 10%) of FBS and PL used. PL, platelet lysate; PI, Propidium Iodide. Positive Ctl, Positive Control.

Figure 13. Cell adhesion assay. The graph shows that wortmannin has no effect on cell adhesion either in presence of FBS or PL. Data are presented as means ±SD.

5. Discussion

PL has been established for a broad range of clinical applications (11), including ophthalmological diseases (44) thanks to its ability to induce tissue regeneration in a paracrine fashion (45-46). Despite this, PL is usually manufactured “in-house”, thus lacking any standardization of soluble factors during its preparation. In addition, although it can be obtained from autologous sources, risk of potential contamination can still occur during the clinical procedure. These limitations can be overcome by a GMP-grade PL formulation, manufactured to strict specific standard procedures in accordance to safety requirements (virally inactivated) (11,47).

Given the presence of numerous soluble factors detected in our PL preparations (11,47), we have attempted to establish whether the PL normally employed in vitro for culturing Mesenchymal stem cells or dermal fibroblasts (11,45,47) could also allow the culturing of human TFs, a widely employed in vitro model of stromal cells for ophthalmological studies. As for Mesenchymal stem cells (11,47), the GMP-grade PL produced in our laboratory enhances human TF cell proliferation. However it does so in a concentration-independent manner, without provoking morphological changes in cell dimension and/or granularity as observed for Mesenchymal stem cells (29) and preserving human TF viability. Also the migratory activity of human TFs is improved in presence of PL. These results confirm the non-specific cell type effect of PL, in agreement with other reports describing similar chemotactic responses in a variety of different cell populations ranging from the myoblast cell line C2C12 to keratinocytes and retinal glial and endothelial cells (48-50).

In addition, our results show that PL compared to FBS can preserve or enhance upregulation of genes such as EGF, MMP2 and 9, VEGF and FGF involved in regeneration or migration of epithelial tissue. Also we did not observe any variation in the expression levels of FAK and alpha-SMA, a myofibroblastic marker, despite the presence in the PL of TGF-beta1 (11-12,47) a fibrotic agent known for inducing myofibroblast activation by acting on both FAK and alpha-SMA (50). For instance, corneal fibroblasts transit to a pro-fibrotic state only when an epithelial injury occurs and the wound healing process starts to switch from the inflammatory to a proliferative phase. Since our system in vitro has been designed in absence of injury and immune response, it is conceivable that both the transition to a fibrotic state and the induction of myofibroblast activation cannot be observed (18). Alternatively, in presence of PL human, TFs could be restricted to a pre-fibrotic state and prone to be committed towards the myofibroblast lineage only after injury occurs.

So far, mechanisms by which PL exerts in vitro its beneficial effects on human TFs have been largely unexplored. Our data highlight that although multiple modulators of the inflammatory response are either present in the media supplemented with PL and FBS, interestingly, specific factors such as GRO, Angiogenin, EGF, I-309 and PARC are exclusively expressed in media containing PL and absent in that with FBS. The above mentioned chemokines/growth factors play a major role in cell differentiation, proliferation, angiogenesis and wound healing (51-53), converging on the activation of main signalling pathways in several biological systems including induction of NO Synthesis, ERK1/2 and AKT (54-57). Nevertheless, our data show that phosphorylation of ERK1/2 is not increased by treatment with PL compared to FBS, whereas the phospho-AKT signal is promptly activated. This is in line with previous studies reporting that the expression of ERK1/2 is unaffected or not essential in skin fibroblasts as well as HUVEC cells after stimulation with PL (23,45). Therefore, the ability of TFs to further proliferate but not to migrate after treatment with PL or FBS and inhibition of the PI3kinase/AKT pathway by wortmannin, suggests an exclusive role not PL-specific for AKT in the migratory event. Other molecular factors are likely to be involved, for instance p38, essential for PL-induced dermal fibroblast wound healing but not for wound closure (24).

A potentially specific property in vitro of PL could be the ability to decrease the oxidative stress levels, resulting in the enhancement of both cell proliferation and migration. Redox reactions, which consist of a fine balance between reductive and oxidative processes, underlie several mechanisms including tissue regeneration (42), lesion repair and wound healing (37). For instance, the management of corneal ulcers in association with antioxidants has been reported where the administration of vitamin C improves the restoration of the stromal matrix following an alkali burn, thus initiating the epithelial regeneration (58). Our study shows for the first time that after in vitro treatment with PL, human TF-derived supernatants contain higher levels of nitrate/nitrite compounds but decreased levels of isoprostanes (unique products of arachidonic acid oxidation) compared to cells cultured in presence of FBS alone. These novel results indicate a greater bioavailability in our conditions of nitric oxide production, that it is involved in enhancing neoangiogenetic processes and in corneal epithelial regeneration (59). Moreover, results indicate also a decrease in isoprostanes production, which is known to exacerbate tissue injury (60), and that may help to reduce the amount of free radical generation and oxidative damage (61-64).

All together our data suggest that PL can be employed as substitute of FBS during human TFs in vitro expansion without altering the biological cell properties. The option to employ PL preparations designed for different clinically conditions even for the in vitro culturing of TFs could broaden the current therapeutic PL-based strategies. For instance, the preconditioning of TFs with PL could reveal an interesting novel tool for limbal stem cell expansion as well an alternative to the FBS to avoid risk of zoonosis for cell banking purposes. Alternatively, the culturing of TFs with PL could reveal a useful in vitro model to investigate the effects of pro-inflammatory cytokines in driving angiogenic and fibrotic process in several ophthalmological diseases.

Finally, a deeper understanding of the molecular basis of the novel biological properties shown in vitro by the PL such as that of reducing the level of oxidative stress, could provide new insights for improving its biochemical formulation and biological efficacy.

Further studies are required in vitro and in vivo to investigate the mechanisms of reduction of oxidative stress and to fully assess the efficacy of the GMP-grade PL prepared in our laboratory also in comparison with different PL preparations and/or blood products.

6. Acknowledgement

Augusto Carducci, Gaia Scafetta, contributed equally to the study. The authors thank to Fondazione Roma, Dr.Colin Murdoch and Dr.Paola Iudicone.

Abbreviations: PL: Platelet lysate; FBS: foetal bovine serum; TFs: Tenon’s fibroblasts; NO: nitric oxide; EGF: epidermal growth factor; FGF: fibroblast growth factor; VEGF: vascular endothelial growth factor; KDR: kinase insert domain receptor; MMP2 and 9: metalloproteinase MMP 2 and 9; FAK: Focal Adhesion Kinase; alpha-SMA: alpha smooth muscle actin

References

    1. P. Watson, B.L. Hazleman, P. Mc Cluskey, C. Pavesio. The sclera and systemic disorders. Third edition. JP Medical Ltd London, UK (2012)

    2. J. Smyth, J.J. More, S. Shapourifar-Tehrani, D.A. Lee: The effect of 5-fluorouridine, 5-fluoredeoxyuridine, and 5-fluorodeoxyuridine monophosphate on rabbit tenon’s capsule fibroblasts in vitro. J Ocul Pharmacol 7, 329–338 (1991)

    3. E.J. O’Neill, Q. Qin, N.J. Van Bergen, P.P. Connell, S. Vasudevan, M.A. Coote, I.A. Trounce, T.T. Wong, J.G. Crowston: Antifibrotic activity of bevacizumab on human Tenon’s fibroblasts in vitro. Invest Ophtalmol Vis Sci 51, 6524–6532 (2010)

    4. E. De Falco, G. Scafetta, C. Napoletano, R. Puca R, E.M. Vingolo, G. Ragona, O. Iorio, G. Frati: A standardized laboratory and surgical method for in vitro culture isolation and expansion of primary human Tenon’s fibroblasts. Cell and Tissue Bank 14, 277-287 (2013)

    5. L. Choritz, J. Grub, M. Wegner, N. Pfeiffer, H. Thieme: Paclitaxel inhibits growth, migration and collagen production of human Tenon’s fibroblasts-potential use in drugeluiting glaucoma drainage devices. Graefes Arch Clin Exp Ophtalmol 248, 197–206 (2010)

    6. G. Scafetta, E. Tricoli, C. Siciliano, C. Napoletano, R. Puca, E.M. Vingolo, G. Cavallaro, A. Polistena, G. Frati, E. De Falco: Suitability of human Tenon’s fibroblasts as feeder cells for culturing human limbal epithelial stem cells. Stem cell Rev 9, 847-857 (2013)

    7. F. Deng, H. Hu, M. Chen, X. Sun, X. Liu, Z. Dong, Y. Liu, L. Xi, J. Zhuang, J. Ge: Generation of induced pluripotent stem cells from human Tenon’s capsule fibroblasts. Mol Vis 18, 2871-2881 (2012)

    8. G. Gstraunthaler: Alternatives to the use of fetal bovine serum: serum-free cell culture. ALTEX, 20, 275-281 (2003)

    9. R. Ross, E.W. Raines, D.F. Bowen-Pope: The biology of platelet derived growth factor. Cell 46, 155-169 (1986)

    10. C.H. Heldin, A. Wasteson, B. Westermark: Platelet-derived growth factor. Mol. Cell. Endocrinol. 39, 169-187 (1985)

    11. C. Siciliano, M. Ibrahim, G. Scafetta, C. Napoletano, G. Mangino, L. Pierelli, G. Frati, E. De Falco: Optimization of the isolation and expansion method of human mediastinal-adipose tissue derived mesenchymal stem cells with virally inactivated GMP-grade platelet lysate. Cytotechnology 67, 165-174 (2013)

    12. E. Anitua, M. Sánchez, G. Orive, I. Andía: The potential impact of the preparation rich in growth factors (PRGF) in different medical fields. Biomaterials 28, 4551-4560 (2007)

    13. J.L. Alio, M. Abad, A. Artola, J.L. Rodriguez-Prats, S. Pastor, J. Ruiz-Colecha: Use of autologous platelet-rich plasma in the treatment of dormant corneal ulcers. Ophthalmology 114, 1286-1293 (2007)

    14. J.F. Korobelnik, D. Hannouche, N. Belayachi, M. Branger M, J.E. Guez, T. Hoang-Xuan: Autologous platelet concentrate as an adjunct in macular hole healing. Ophthalmology 103, 590-594 (1996)

    15. S. Gehring, H. Hoerauf, H. Laqua, H. Kirchner, H. Klüter: Preparation of autologous platelets for the ophthalmologic treatment of macular holes. Transfusion 39, 144-148 (1999)

    16. J. Wachtlin, C. Jandeck, S. Potthofer, U. Kellner, M.H. Foerster: Long-term results following pars plana vitrectomy with platelet concentrate in pediatric patients with traumatic macular hole. Am J Ophthalmol 136, 197-199 (2003)

    17. B.J. Vote, W.L. Membrey, A.G. Casswell: Autologous platelets for macular hole surgery: the Sussex Eye Hospital experience. Clin Experiment Ophthalmol 32, 472-477 (2004)

    18. W. Geremicca, C. Fonte, S. Vecchio: Blood components for topical use in tissue regeneration: evaluation of corneal lesions treated with platelet lysate and considerations on repair mechanisms. Blood Transfus 8, 107-112 (2010)

    19. S. Werner, R. Grose: Regulation of wound healing by growth factors and cytokines. Physiol Rev 83, 835-870 (2003)

    20. E. Anitua, I. Andıa, B. Ardanza, P. Nurden, A.T. Nurden: Autologous platelets as a source of proteins for healing and tissue regeneration. Thromb Haemost 91, 4-15 (2004)

    21. G.C. Leitner, R. Gruber, J. Neumüller, A. Wagner, P. Kloimstein, P. Höcker, G.F. Körmöczi, C. Buchta: Platelet content and growth factor release in platelet rich plasma: a comparison of four different systems. Vox Sang 91, 135-139 (2006)

    22. V. Mirabet, P. Solves, M.D. Miñana, A. Encabo, F. Carbonell-Uberos, A. Blanquer, R. Roig: Human platelet lysate enhances the proliferative activity of cultured human fibroblast-like cells from different tissues. Cell Tissue Bank 9, 1-10 (2008)

    23. E. Ranzato, F. Boccafoschi, L. Mazzucco, M. Patrone, B. Burlando: Role of ERK1/2 in Platelet Lysate-Driven Endothelial Cell Repair. J Cell Biochem 110, 783-793 (2010)

    24. E. Ranzato, L. Mazzucco, M. Patrone, B. Burlando: Platelet lysate promotes in vitro wound scratch closure of human dermal fibroblasts: different roles of cell calcium, P38, ERK and PI3K/AKT. J Cell Mol Med 13, 2030-2038 (2009)

    25. D. Bastianelli, C. Siciliano, R. Puca, A. Coccia A, C. Murdoch, A. Bordin, G. Mangino, G. Pompilio, A. Calogero, E. De Falco: Influence of egr-1 in cardiac tissue-derived mesenchymal stem cells in response to glucose variations. Biomed Res Int 2014, 254793 (2014)

    26. C. Menna, E. De Falco, L. Pacini, G. Scafetta, P. Ruggieri, R. Puca, V. Petrozza, A.M. Ciccone, E.A. Rendina, A. Calogero, M. Ibrahim: Axitinib affects cell viability and migration of a primary foetal lung adenocarcinoma culture. Cancer Invest 32, 13-21 (2014)

    27. A. Coccia, D. Bastianelli, L. Mosca, R. Monticolo R, I. Panuccio, A. Carbone, A. Calogero, E. Lendaro: Extra Virgin Olive Oil Phenols Suppress Migration and Invasion of T24 Human Bladder Cancer Cells Through Modulation of Matrix Metalloproteinase-2. Nutr Cancer 66, 946-54 (2014)

    28. L. Pacini, E. De Falco, M. Di Bari, A. Coccia, C. Siciliano, D. Ponti, A.L. Pastore, V. Petrozza, A. Carbone, A.M. Tata, A. Calogero: M2 muscarinic receptors inhibit cell proliferation and migration in urothelial bladder cancer cells. Cancer Biol Ther 15, 1489-1498 (2014)

    29. B.A. Naaijkens, H.W.M. Niessen, H.J. Prins, P.A.J. Krijnen, T.J. Kokhuis, N. de Jong, V.W. van Hinsbergh, O. Kamp, M.N. Helder, R.J. Musters, A. van Dijk, L.J. Juffermans: Human platelet lysate as a fetal bovine serum substitute improves human adipose-derived stromal cell culture for future cardiac repair applications. Cell Tissue Res 348, 119-130 (2012)

    30. B.J. Tripathi, P.S. Kwait, R.C. Tripathi: Corneal growth factors: a new generation of ophthalmic pharmaceuticals. Cornea 9, 2-9 (1990)

    31. G. Schultz, N. Chegini, M. Grant, P. Khaw, S. MacKay: Effects of growth factors on corneal wound healing. Acta Ophthalmol Suppl 102, 60-66 (1992)

    32. F. Haq, V. Trinkaus-Randall: Injury of stromal fibroblasts induces phosphorylation of focal adhesion proteins. Curr Eye Res 17, 512-523 (1998)

    33. J.T. Daniels, A.D. Cambrey, N.L. Occleston, Q. Garrett, R.W. Tarnuzzer, G.S. Schultz, P.T. Khaw: Matrix Metalloproteinase Inhibition Modulates Fibroblast-Mediated Matrix Contraction and Collagen Production in vitro. Invest Ophthalmol Vis Sci 44, 1104-1110 (2003)

    34. V. Sing, F.L. Barbosa, A.A. Torricelli, M.R. Santhiago MR, S.E. Wilson: Transforming growth factor β and platelet-derived growth factor modulation of myofibroblast development from corneal fibroblasts in vitro. Exp Eye Res 120, 152-160 (2014)

    35. H. Sun, E. Calle, X. Chen, A. Mathur A, Y. Zhu, J. Mendez, L. Zhao, L. Niklason, X. Peng, H. Peng, E.L. Herzog. Fibroblast engraftment in the decellularized mouse lung occurs via a β1-integrin-dependent, FAK-dependent pathway that is mediated by ERK and opposed by AKT. Am J Physiol Lung Cell Mol Physiol 306, 463-475 (2014)

    36. A. Shoham, M. Hadziahmetovic, J.L. Dunaief, M.B. Mydlarski, H.M. Schipper: Oxidative stress in diseases of the human cornea. Free Radic Biol Med 45, 1047-1055 (2008)

    37. I.M. Cheung, C.N. McGhee, T. Sherwin: A new perspective on the pathobiology of keratoconus: interplay of stromal wound healing and reactive species-associated processes. Clin Exp Optom 96, 188-196 (2013)

    38. G. Seghezzi, S. Patel, C.J. Ren, A. Gualandris, G. Pintucci, E.S. Robbins, I. Richard, R.L. Shapiro, A.C. Galloway, D.B. Rifkin, P. Mignatti: Fibroblast Growth Factor-2 (FGF-2) Induces Vascular Endothelial Growth Factor (VEGF) Expression in the Endothelial Cells of Forming Capillaries: An Autocrine Mechanism Contributing to Angiogenesis. J Cell Biol 141, 1659–1673 (1998)

    39. S. Chen, Y. Su, J. Wang: ROS-mediated platelet generation: a microenvironment-dependent manner for megakaryocyte proliferation, differentiation, and maturation. Cell Death Dis 4, e722 (2013)

    40. P. Sambo, S.S Baroni, M. Luchetti, P. Paroncini, S. Dusi, G. Orlandini, A. Gabrielli: Oxidative stress in scleroderma: maintenance of scleroderma fibroblast phenotype by the constitutive up-regulation of reactive oxygen species generation through the NADPH oxidase complex pathway. Arthritis Rheum 44, 2653-2654 (2011)

    41. Sandri G, Bonferoni MC, Rossi S, Ferrari F, et al. Platelet lysate formulations based on mucoadhesive polymers for the treatment of corneal lesions. J Pharm Pharmacol 2011;63(2):189-98

    42. N.R. Love, Y. Cheng, S. Ishibashi, P. Kritsiligkou, R. Lea, Y. Koh, J.L. Gallop, K. Dorey, E. Amaya: Amputation-induced reactive oxygen species (ROS) are required for successful Xenopus tadpole tail regeneration. Nat Cell Biol. 15, 222-228 (2013)

    43. R. Carnevale, G. Biondi-Zoccai, M. Peruzzi, E. De Falco E, I. Chimenti, F. Venuta, M. Anile, D. Diso, E. Cavarretta, A.G. Marullo, P. Sartini, P. Pignatelli, F. Violi, G. Frati: New insights into the steen solution properties: breakthrough in antioxidant effects via NOX2 downregulation. Oxid Med Cell Longev, 2014, 242180 (2014)

    44. S. Vecchio, E. Santilli, A.R. D’Ettoris, V. Musuraca: The use of platelet-rich plasma for the topical treatment of corneal lesions. Blood Transfus 4, 133-140 (2006)

    45. V. Cipriani, E. Ranzato, V. Balbo, L. Mazzucco, M. Cavaletto, M. Patrone: Long-term effect of platelet lysate on primary fibroblasts highlighted with a proteomic approach. J Tissue Eng Regen Med 3, 531-538 (2009)

    46. R. Ito, N. Morimoto, L.H. Pham, T. Taira, K. Kawai, S. Suzuki: Efficacy of the controlled release of concentrated platelet lysate from a collagen/gelatin scaffold for dermis-like tissue regeneration. Tissue Eng Part A 19, 1398-1405 (2013)

    47. P. Iudicone, D. Fioravanti, G. Bonanno, M. Miceli, C. Lavorino, P. Totta, L. Frati, M. Nuti, L. Pierelli: Pathogen-free, plasma-poor platelet lysate and expansion of human mesenchymal stem cells. J Transl Med 27, 12-28 (2014)

    48. P. Hofbauer, S. Riedl, K. Witzeneder, F. Hildner, S. Wolbank, M. Groeger, C. Gabriel, H. Redl, W. Holnthoner: Human platelet lysate is a feasible candidate to replace fetal calf serum as medium supplement for blood vascular and lymphatic endothelial cells. Cytotherapy 16, 1238-1244 (2014)

    49. E. Ranzato, V. Balbo, F. Boccafoschi, L. Mazzucco, B. Burlando: Scratch wound closure of C2C12 mouse myoblasts is enhanced by human platelet lysate. Cell Biol Int 33, 911-917 (2009)

    50. S. Hong, J.B. Lee, Y. Iizuka, Y.K. Song, G.J. Seong, S.H. Han: The Role of Focal Adhesion Kinase in the TGF-beta-Induced Myofibroblast Transdifferentiation of Human Tenon’s Fibroblasts. Korean J Ophthalmol 26, 45-48 (2012)

    51. M.D. Miller, M.S. Krangel: Biology and biochemistry of the chemokines: a family of chemotactic and inflammatory cytokines. Crit Rev Immunol 12, 17-46 (1992)

    52. S.H. Lee, K.W. Kim, K.M. Min, K.W. Kim, S.I. Chang, J.C. Kim: Angiogenin Reduces Immune Inflammation via Inhibition of TANK-Binding Kinase 1 Expression in Human Corneal Fibroblast Cells. Mediators Inflamm 2014, 861435 (2014)

    53. E.B. Márquez, D. De Ortueta, S.B. Royo, P.A. Martínez-Carpio: Epidermal growth factor receptor in corneal damage: update and new insights from recent reports. Cutan Ocul Toxicol 30, 7-14 (2011)

    54. R. Trouillon, D.K. Kang, H. Park, S.I. Chang, D. O’Hare: Angiogenin induces nitric oxide synthesis in endothelial cells through PI-3 and Akt kinases. Biochemistry 49, 3282-3288 (2010)

    55. A.G. Trinidad, M.L. de la Puerta, N. Fernández, Y. Bayón Y, M.S. Crespo, A. Alonso: Coupling of C3bi to IgG inhibits the tyrosine phosphorylation signaling cascade downstream Syk and reduces cytokine induction in monocytes. J Leukoc Biol 79, 1073-1082 (2006)

    56. R. Yanai, N. Yamada, N. Kugimiya, M. Inui M, T. Nishida: Mitogenic and antiapoptotic effects of various growth factors on human corneal fibroblasts. Invest Ophthalmol Vis Sci 43, 2122-2126 (2002)

    57. C.S. Mitsiades, N. Mitsiades, M. Koutsilieris: The Akt pathway: molecular targets for anti-cancer drug development. Curr Cancer Drug Targets 4, 235-256 (2004)

    58. B.D. Ashby, Q. Garrett, M.D.P. Willcox: Corneal Injuries and Wound Healing – Review of Processes and Therapies. Austin J Clin Ophthalmol 1, 25 (2014)

    59. A. Soneja, M. Drews, T. Malinski: Role of nitric oxide, nitroxidative and oxidative stress in wound healing. Pharmacol Rep 57, 109-119 (2005)

    60. Y. Liang, P. Wei, R.W. Duke, P.D. Reaven, S.M. Harman, R.G. Cutler, C.B. Heward: Quantification of 8-iso-prostaglandin-F(2alpha) and 2,3-dinor-8-iso-prostaglandin-F(2alpha) in human urine using liquid chromatography-tandem mass spectrometry. Free Radic Biol Med 34, 409-418 (2003)

    61. J.D. Morrow, K.E. Hill, R.F. Burk, T.M. Nammour, K.F. Badr, L.J. Roberts: A series of prostaglandin F2-like compounds are produced in vivo in humans by a non-cyclooxygenase, free radical-catalyzed mechanism. Proc Natl Acad Sci USA 87, 9383-9387 (1990)

    62. J.D. Morrow: The isoprostanes: their quantification as an index of oxidant stress status in vivo. Drug Metab Rev 32, 377-385 (2000)

    63. M.R. McCall, B. Frei: Can antioxidant vitamins materially reduce oxidative damage in humans? Free Radic Biol Med 26, 1034-1053 (1999)

    64. Pratico D: F2-Isoprostanes: sensitive and specific non-invasive indices of lipid peroxidation in vivo. Atherosclerosis 147, 1-10 (1999)

Share and Cite
Augusto Carducci, Gaia Scafetta, Camilla Siciliano, Roberto Carnevale, Paolo Rosa, Andrea Coccia, Giorgio Mangino, Antonella Bordin, Enzo Maria Vingolo, Luca Pierelli, Eugenio Lendaro, Giuseppe Ragona, Giacomo Frati, Elena De Falco. GMP-grade platelet lysate enhances proliferation and migration of tenon fibroblasts. Frontiers in Bioscience-Elite. 2016. 8(1); 84-99.